ID: 965349305

View in Genome Browser
Species Human (GRCh38)
Location 3:167594280-167594302
Sequence CAAAATGTTCATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 4, 2: 49, 3: 114, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965349305 Original CRISPR CAAAATGTTCATAGTGATAT GGG Intronic
904025915 1:27503718-27503740 CAAAATATTCAGAGTGAGCTGGG - Intergenic
904405016 1:30282641-30282663 TAAAGTGTTCTTAGAGATATTGG - Intergenic
905438948 1:37980645-37980667 CAAAAAGTTCATTCTGATCTTGG + Exonic
905457959 1:38101290-38101312 AAAAAATTTCATAGTGAGATTGG + Intergenic
906185049 1:43855949-43855971 CAAACTGTTCATAAAGAAATAGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909542475 1:76806429-76806451 CAGAATGTTGGTAGAGATATAGG + Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
910196023 1:84640387-84640409 CAAACTTTTGATAGTGAAATGGG - Intergenic
910357950 1:86381903-86381925 CAAAATGTTAACAATGATTTTGG + Intronic
911154935 1:94628021-94628043 CAAACTGGTCATAGTCATTTAGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916584580 1:166139503-166139525 TAAAATGGCCATAGTGATAGAGG + Intronic
917139044 1:171816334-171816356 CAAAGCGTTCATAGTCAAATGGG - Intergenic
918304239 1:183231425-183231447 GAAATTTTTCAAAGTGATATGGG + Intronic
919273939 1:195387216-195387238 CACCATGTTCATATTTATATAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921316520 1:213896773-213896795 CAAAATTTTAATAGTGGTATTGG - Intergenic
921803037 1:219423286-219423308 CAAAATGTCCATAGACATTTTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923170210 1:231409120-231409142 CAAAATTTTCAAACTGATAAAGG + Intronic
923800240 1:237202017-237202039 TAAAATGTTCGTAGAGAAATGGG + Intronic
924309138 1:242721765-242721787 CAAATTGTTTTTAGTGATTTCGG + Intergenic
1066211675 10:33246097-33246119 CAAAATGGTCAAAATCATATTGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068042375 10:51841328-51841350 CAAACAGTTCATAGTCAAATGGG + Intronic
1068312411 10:55294694-55294716 CAATATGTTCATAGGCTTATTGG - Intronic
1068749700 10:60577841-60577863 AAAAATGATCACAGTGACATTGG + Intronic
1071105066 10:82084645-82084667 CAAAATGTTCACAGAAAAATAGG - Intronic
1071324921 10:84504187-84504209 CTAAATGCTCATATTTATATGGG - Intronic
1071670383 10:87603724-87603746 CAAAATATTCAAAGAGATAAAGG - Intergenic
1072205629 10:93202797-93202819 CAAATTTTTCACAGTGATAGTGG + Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073386958 10:103133805-103133827 AAAAATATTGATAGTGACATGGG + Intronic
1075477556 10:122749456-122749478 CAGAATGTTCATAACCATATTGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078234083 11:9467930-9467952 CAAATTGCTCATCGTGACATAGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078886691 11:15507382-15507404 CTAAATGTATATGGTGATATGGG - Intergenic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079827092 11:25210956-25210978 TAAAATTTTAATAGTTATATCGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080362764 11:31535088-31535110 CAAAATGTACTTAATGATTTAGG - Intronic
1080762865 11:35269372-35269394 CAAAATATTAATAGTTATTTTGG - Intronic
1081028102 11:38041002-38041024 AGAAATGTTAATAGAGATATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082037320 11:47655754-47655776 CAAAATGTTCTTATTGCTAATGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1085438517 11:76534225-76534247 AGAAATTTTCATAATGATATAGG - Intronic
1086459397 11:86991060-86991082 CAAAAAGTTCTTACTGATCTGGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1088800717 11:113304836-113304858 CAAAATGTTAATAGTACTGTTGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093350043 12:18087912-18087934 TAAAATGTTCATAATGTCATAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094877230 12:34663331-34663353 CAGAATGTGCAAAGGGATATTGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097582082 12:61470760-61470782 CAAAATGTTCATTATGATAACGG + Intergenic
1097943365 12:65337924-65337946 CAAAAAGTTCATAGTTTTGTTGG - Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099608092 12:84830007-84830029 GAAAATGTTCAAATTAATATAGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099828587 12:87811443-87811465 CCAAATATTCATAGTGATAAAGG + Intergenic
1100579109 12:95921889-95921911 CAAAATGATTCTAGTGATTTGGG - Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101363415 12:104049130-104049152 CCAAATATCCAAAGTGATATTGG - Intronic
1101393684 12:104324863-104324885 CAGCAGGTCCATAGTGATATGGG - Intronic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1103113379 12:118302860-118302882 CAAAATGGTAGTCGTGATATTGG - Intronic
1103330051 12:120148035-120148057 AAATATGTTCACAGTGAAATAGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1108462742 13:50683496-50683518 CAAAATCTTCATAGGACTATGGG + Intronic
1108860161 13:54847567-54847589 TAAAATGTTCATAGTCTCATAGG + Intergenic
1109030291 13:57181327-57181349 CATAGTGATCATAGTGATAATGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110261956 13:73495504-73495526 CAAAATGTTCAAAATGAGCTAGG + Intergenic
1110399433 13:75072649-75072671 CAAAATGTTCATGGGAACATAGG - Intergenic
1110886964 13:80651735-80651757 CTAACTATACATAGTGATATAGG + Intergenic
1110947091 13:81435709-81435731 CCAGATTTTCAGAGTGATATTGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111647158 13:91045983-91046005 GAAAATGTTAATAATTATATTGG - Intergenic
1112095666 13:96129232-96129254 GAAAATGTTGGTGGTGATATAGG + Intronic
1112553655 13:100446429-100446451 CAAAATGTACAAAGTATTATGGG - Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112981689 13:105392722-105392744 GAAAAGGTTCATAGAGATTTGGG + Intergenic
1113355756 13:109578393-109578415 CAATTTGTTCATAGTGTTAAAGG + Intergenic
1114279852 14:21182596-21182618 GAAAATGTACCTAGTGAAATGGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116644341 14:47507640-47507662 CAACTTGTCCCTAGTGATATAGG + Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1118561147 14:67084504-67084526 GAAAATGTACAGGGTGATATGGG - Intronic
1119210518 14:72828280-72828302 CAACAGGTTCATAGAGCTATGGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121987842 14:98525720-98525742 GAAAATGTTTATAGGGAGATTGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123377144 15:19605003-19605025 CAGAATCTTCTTTGTGATATTGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124615352 15:31237576-31237598 AAAAATGTTCATCATGAGATAGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127559825 15:60125078-60125100 TGAAATGTTCATAATGAGATGGG + Intergenic
1127664365 15:61130816-61130838 CAAAATGTTCATAATAAAATGGG + Intronic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1134763578 16:16735836-16735858 CAAATTGTTCTTAGTGACCTGGG + Intergenic
1134982474 16:18623321-18623343 CAAATTGTTCTTAGTGACCTGGG - Intergenic
1135229960 16:20697447-20697469 CAAAATGACAATGGTGATATTGG - Intronic
1136043048 16:27595457-27595479 CAAGTTGTTCATTGTGATAGAGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140228722 16:73099814-73099836 CCAAATGTTCAGAGTCATCTGGG + Intergenic
1141069760 16:80943024-80943046 CACAATCTTCAAAGAGATATAGG - Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1146158264 17:30542452-30542474 GAAAATGTTCATAGTAATGATGG - Intergenic
1149471342 17:56917614-56917636 CAAAATGATCATAGTTATTATGG - Intergenic
1155729258 18:29131923-29131945 AAAATTTTTCATAGTGAAATTGG + Intergenic
1156150976 18:34242441-34242463 CAAAAAGAACAAAGTGATATAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1159687395 18:71439366-71439388 AAAAATGTTAAGAGTGATAAAGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166018173 19:39999537-39999559 CAAAGTGTTAATAGTGATGCTGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925824234 2:7831493-7831515 CAAACTGTTCAAGGTGAAATAGG + Intergenic
927131107 2:20061594-20061616 CAAAACTTTCATAGTGAAAGTGG + Intergenic
928346613 2:30503325-30503347 ATAAATGTTCATAGTGAGATAGG - Intronic
928668209 2:33573005-33573027 CAAAATCTTCTTAGTGTTTTTGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930896473 2:56452258-56452280 AAAAATGTTCATAGACATACAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931901303 2:66791386-66791408 GAAAATGTTCAGTGTGCTATGGG + Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933987569 2:87604576-87604598 CAAAATGTACACAGTGAAACCGG - Intergenic
934094790 2:88590886-88590908 CATAATGGACATAGTGATAAAGG - Exonic
936306271 2:111346232-111346254 CAAAATGTACACAGTGAAACCGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939580446 2:143940024-143940046 CAAAACGTTAATAGTGGAATGGG - Exonic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940677496 2:156742979-156743001 CCAAATATTTATAGTGTTATGGG + Intergenic
941541097 2:166785602-166785624 AAAAATGTTAATAGAGATAAGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942870298 2:180726398-180726420 CACAATGTTCCTAGAGAAATAGG + Intergenic
942905638 2:181177271-181177293 TAAAATGTTCACAGTGAAATTGG - Intergenic
943013969 2:182489036-182489058 AAAAATGTACAGACTGATATTGG + Intronic
943279446 2:185912701-185912723 CAAAATGTGCATAGGAAAATAGG + Intergenic
943351049 2:186796690-186796712 CCCAATGTTCATAGGGATATTGG - Intergenic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
945390118 2:209255297-209255319 AAGAATATTCCTAGTGATATTGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946829531 2:223713817-223713839 CAAGATTTACATAGTGATATAGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948545353 2:238724585-238724607 CAAACCGTTCAAAGAGATATAGG + Intergenic
949049439 2:241889142-241889164 TAAATTGTTCATAGAAATATAGG + Intergenic
1169173816 20:3490388-3490410 CAAAAAGTTCATTCTGATCTTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1172392916 20:34578394-34578416 AGAAATGTACATAGTGATGTTGG - Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1175023819 20:55880422-55880444 CAAAAAGTTTAAAGGGATATAGG - Intergenic
1175596936 20:60242812-60242834 TAAAATGATCATCTTGATATTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176940424 21:14917375-14917397 CAAAAAGTTCAAAGTGAGAGTGG + Intergenic
1177244837 21:18509920-18509942 CAATATGTTGACAGTGAAATGGG + Intergenic
1177311892 21:19408432-19408454 GCAAAAGTTCATAGTGATACTGG + Intergenic
1177348897 21:19909756-19909778 CCAAATGTTTATACTGATGTAGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177605689 21:23375309-23375331 AAAAATGTTCATAGTGAGTTGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178642834 21:34360232-34360254 CAAAATATTCAAAGTGAAACAGG - Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181505233 22:23351637-23351659 TTAATTGCTCATAGTGATATAGG - Intergenic
1181574333 22:23784089-23784111 CAAAAAGTTCACAGTCAAATGGG + Exonic
1182935183 22:34215498-34215520 CAAGATCGTCATAGTGATTTAGG - Intergenic
949769636 3:7565615-7565637 CAAATTGTGCACAGTTATATGGG + Intronic
950346443 3:12298360-12298382 CACAATGTTCACACTGATTTTGG - Intronic
950381383 3:12618409-12618431 CAAAATATTCATTGTCATTTAGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
956135340 3:66092986-66093008 CAAAATGTTCATTTTTATAATGG - Intergenic
956340416 3:68216840-68216862 CAAAATGAATAAAGTGATATGGG + Intronic
956685907 3:71827151-71827173 CAAAATGTTCAGAGTTAATTAGG - Intergenic
958113833 3:89188567-89188589 CAATATGTAGATGGTGATATTGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958583342 3:96053796-96053818 AAAAATGTGGATAGTGATGTGGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959594623 3:108115702-108115724 CAAAAAATACTTAGTGATATGGG - Intergenic
959678439 3:109064918-109064940 CAAAATCTTCAGAATGATAGAGG - Intronic
961023991 3:123536139-123536161 TAAAATTTACATATTGATATAGG - Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963291920 3:143499699-143499721 AAAAATGTTCATTTTGAGATTGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963554409 3:146770363-146770385 CAAAATATTCATAGTTCAATAGG + Intergenic
963973941 3:151460226-151460248 GAAAATGTACATAATGAAATAGG + Intergenic
964007557 3:151850346-151850368 CAGTTTCTTCATAGTGATATTGG + Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965115374 3:164481535-164481557 CAGAATATTCATAGATATATAGG + Intergenic
965324230 3:167282058-167282080 AAACATATTCAGAGTGATATCGG + Intronic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966284071 3:178272414-178272436 CACAATTTTCACTGTGATATTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967609483 3:191486605-191486627 ATAAATGTTCATTGGGATATTGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971541657 4:27824972-27824994 AAAAATGTTCATAGGGAAAATGG + Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971774549 4:30945913-30945935 CATAATGTCCATAATGTTATAGG - Intronic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
972426760 4:38940642-38940664 CAAAATTTACATAGTGAAAAAGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974406597 4:61479771-61479793 AACAATGTTCCTAATGATATGGG + Intronic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974823113 4:67093208-67093230 CAATATCTTCTTAGTCATATAGG - Intergenic
976279110 4:83309077-83309099 AAATATGTTCATAGTCATTTAGG + Intronic
976316442 4:83663926-83663948 CTCAATGTTCCTTGTGATATAGG + Intergenic
976335748 4:83883879-83883901 CAAAATGTTTAAGGTGACATAGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG + Intergenic
977946806 4:102923127-102923149 ATCAATGTTCATAGGGATATTGG - Intronic
978942415 4:114452579-114452601 TAAAATGTTCATACTGATCAAGG + Intergenic
979043183 4:115826324-115826346 AAAAATGTTCAAAGTAATTTTGG - Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979362811 4:119784286-119784308 CCAAATATTGATAGTGATGTGGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
980217420 4:129870482-129870504 AAAAATGTTCAGAGTGATGCCGG + Intergenic
980386728 4:132094743-132094765 CAAAATATTCAGAGTTATAATGG - Intergenic
980388491 4:132117248-132117270 CAAAATATTAATAATAATATGGG + Intergenic
980534350 4:134096456-134096478 CAAAATATTCATAAAAATATTGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982894378 4:160899316-160899338 CCAAATGTTGATACTGGTATTGG + Intergenic
983013244 4:162576610-162576632 AAAAATGTTGATAGTGGTAGAGG + Intergenic
983250637 4:165342321-165342343 AAAATTCTTCATAGTGGTATTGG + Exonic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983416715 4:167465935-167465957 CAATATGAATATAGTGATATTGG - Intergenic
983607115 4:169600083-169600105 GAAAATGTTAAAAGTGATATTGG - Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984213292 4:176877074-176877096 GAAAATGTTCTTAGTGAGATGGG + Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986120235 5:4828487-4828509 TATAATGTTTATAGTGATAGAGG - Intergenic
986382630 5:7202108-7202130 AAAAATGTTCAGAATGATATTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987008306 5:13733968-13733990 CATCATTTTCATAGTGTTATGGG + Intronic
987798205 5:22657211-22657233 CAAAATCATAATAGTGGTATTGG + Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989348001 5:40451996-40452018 CAATATCTTCATAGTGTCATTGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989879422 5:46754427-46754449 CAAAAGGTTCTTTGTGATGTGGG + Intergenic
989896634 5:47096708-47096730 CAAAATCTTCCTTGTGATGTGGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990080465 5:51906651-51906673 GAAAATTTTCATAGTAATATGGG + Intergenic
990454622 5:55973048-55973070 CATAATGTTCATTGTAATATCGG - Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991262025 5:64677659-64677681 CAAAATGTACATAGTTCTTTTGG - Intergenic
991733521 5:69611284-69611306 CAAAATGTTCATGTTGGTAGAGG - Intergenic
991734371 5:69618238-69618260 ATAAATGTTCATTGTGATATAGG + Intergenic
991780608 5:70128487-70128509 ATAAATGTTCATTGTGATATAGG - Intergenic
991809955 5:70466430-70466452 CAAAATGTTCATGTTGGTAGAGG - Intergenic
991810804 5:70473373-70473395 ATAAATGTTCATTGTGATATAGG + Intergenic
991859896 5:71003910-71003932 ATAAATGTTCATTGTGATATAGG - Intronic
991861433 5:71016566-71016588 CAAAATGTTCATGTTGGTAGAGG + Intronic
991873056 5:71128806-71128828 ATAAATGTTCATTGTGATATAGG - Intergenic
992161272 5:74005642-74005664 AAAAATGTTCATAGAAATAATGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993664874 5:90683707-90683729 CAATATCTCCACAGTGATATTGG - Exonic
993740674 5:91534782-91534804 CAAAATGTTCATATGGAAAGGGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993910244 5:93673448-93673470 CAAGAAGTTCATACTGCTATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994466997 5:100148893-100148915 CAAAATTTTCATTGTTATATTGG - Intergenic
994470563 5:100199681-100199703 CATAATGTCCATAATGCTATAGG - Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996020417 5:118585389-118585411 CAAATTATTCATATTTATATTGG - Intergenic
996191086 5:120542411-120542433 GAAAATGTTAATAGTGATAGAGG - Intronic
996603329 5:125291948-125291970 TAAAATGTTCATTGTTCTATAGG - Intergenic
997111461 5:131079519-131079541 TAAAGTGTTCCTGGTGATATTGG - Intergenic
997581175 5:135018328-135018350 AAAAATATTCATAGTGGTTTGGG + Intergenic
999715576 5:154357376-154357398 CAAAATGTTAATAGTGGTCTGGG + Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1202772312 5_GL000208v1_random:20068-20090 CAAAATCTTCCTTGTGATGTGGG - Intergenic
1003768708 6:9272102-9272124 TAAAATGTTCATATTTATAAGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1003926142 6:10879752-10879774 AAAAAAGTTCATATTGACATGGG + Intronic
1004091471 6:12506939-12506961 CAAAATGTTCATGATCAGATAGG - Intergenic
1005160252 6:22851410-22851432 TAAAAAGTTAATAGTGAAATTGG - Intergenic
1005363745 6:25056794-25056816 CAAAATGTGCTTAGTGAGAGTGG + Intergenic
1005808405 6:29496547-29496569 CAAAGTCTTCTTAGTGAGATGGG - Intergenic
1006213738 6:32420370-32420392 CAAAATGTTCAAAGGGCTAGAGG + Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007466782 6:42057962-42057984 CTAAATGTTCATAGTAATTTTGG + Intronic
1007529166 6:42525687-42525709 CAAAATGTTAATATTGTTGTTGG - Intergenic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1008952966 6:57181080-57181102 CAGAATGTTGGTAGGGATATGGG + Intronic
1009249527 6:61280677-61280699 CCAAATGTTCATACTCAGATTGG + Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011489765 6:87878985-87879007 CAAAATTTTGATAGTGATGGTGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012652068 6:101767357-101767379 CAAAATGTTTATAATGGTAATGG - Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013195955 6:107845776-107845798 GTAAATGTTCATAGTAATTTGGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016627905 6:146194141-146194163 CAACATTTTCATATTGATATTGG + Intronic
1018887688 6:167955061-167955083 CAAAGTGTTCATTGTCATATTGG + Intronic
1018965248 6:168480400-168480422 GAAAATGTTAATAAAGATATAGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020370486 7:7426990-7427012 CAATATGTTTATGGTGATGTGGG + Intronic
1020692730 7:11377379-11377401 CAAGATGTTATTAATGATATTGG + Intronic
1020921181 7:14266514-14266536 AAAAATGTTTATAGTTATAAAGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1020983759 7:15106607-15106629 CAAAGTGTGAATAGAGATATAGG - Intergenic
1021018219 7:15562860-15562882 CAAAATGTTAATAGCGTTTTGGG - Intergenic
1021143414 7:17055226-17055248 GAAAATGTTCATAGTGTTGGGGG - Intergenic
1023516267 7:41004918-41004940 CAATATGTTTATTGTGACATCGG + Intergenic
1024172191 7:46801352-46801374 CAAAATGTTCATATTGTCTTTGG + Intergenic
1024343926 7:48293491-48293513 CAACATATTCTTACTGATATTGG - Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024521299 7:50306266-50306288 AAATATGTTCATGGTGAAATTGG - Intronic
1025062881 7:55826312-55826334 CAAAATTCTCTTTGTGATATAGG - Intronic
1027443283 7:78243304-78243326 CAAAATGTTAATAGCAATGTGGG + Intronic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031504014 7:122558704-122558726 AGAAATGTTTAGAGTGATATGGG + Intronic
1031761849 7:125723070-125723092 TAAAATGTTCATATTGATGATGG - Intergenic
1033276685 7:139976802-139976824 GCAAATGTGCATAGTGACATTGG + Intronic
1033325424 7:140374073-140374095 CAAAATGTTTTTGGTTATATGGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035146014 7:156818058-156818080 CTAAATGTTCCTAGTCATTTGGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037092589 8:14941188-14941210 CAAAATGTAGAAAGTTATATTGG - Intronic
1038013272 8:23492061-23492083 GAAAATTTTCATAGGCATATTGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039864891 8:41491582-41491604 CAAAATGGTCATCAGGATATAGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1043315147 8:78911286-78911308 CAAAATGTTAATAGTGAACATGG - Intergenic
1043549191 8:81349760-81349782 CACAGTGTTCACAGCGATATGGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043862212 8:85332797-85332819 CAATATGTTCAAAGTTATACAGG + Intronic
1043939698 8:86183380-86183402 AAATATGTTCATTGTTATATTGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046025893 8:108723323-108723345 CAAAATGTTCATAATGTCCTTGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046851762 8:118982529-118982551 CAAAATGTTCCAAGTGCTGTAGG + Intergenic
1047855399 8:128904043-128904065 CTAGATGTTCATAGTTACATGGG + Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050517269 9:6457934-6457956 ATCAATGTTCATAGGGATATTGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052138670 9:24949142-24949164 CTACATGTGCTTAGTGATATGGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052641633 9:31174785-31174807 AGAAATGTGCATAGTCATATGGG - Intergenic
1053093466 9:35302204-35302226 CCAAATATTCATAGTGATCTAGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056262592 9:84863671-84863693 CAAAATGTTCACAGAAAAATGGG + Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058503979 9:105650345-105650367 CAAGATTTTTATATTGATATAGG + Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060063840 9:120485255-120485277 CAAAATGTTTATAGATTTATTGG - Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186604253 X:11073057-11073079 TAAAATGTTCATACTTTTATAGG + Intergenic
1186690680 X:11972057-11972079 CAAAAATTTCAAAGTGATGTAGG + Intergenic
1188052520 X:25505500-25505522 CAAAATGTCCATGTGGATATGGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189136319 X:38554456-38554478 AAAAAAGTTCATAAAGATATTGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190619668 X:52272932-52272954 CAAAATGTCTATAGTTAAATTGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193829478 X:86271635-86271657 CAAAATGTACATTTTGATTTGGG + Intronic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194093148 X:89602742-89602764 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1194270731 X:91811427-91811449 TAAAATGTTAACAGTGAGATTGG + Intronic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1195027945 X:100897071-100897093 CTTAATGTTAATAGTAATATTGG + Intergenic
1195843522 X:109201400-109201422 CCAAATTTTCATATTGTTATAGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197531294 X:127630255-127630277 TAAAATGTTCTTGATGATATTGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198929246 X:141836195-141836217 CAAAATGTCAATAGTAATAAAGG - Intergenic
1200445779 Y:3258845-3258867 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1200587964 Y:5032860-5032882 TAAAATGTTAACAGTGAGATTGG + Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1200826732 Y:7652489-7652511 CAAAATATTCATAGTTTAATTGG - Intergenic
1200909899 Y:8522590-8522612 CAAAATATTCATAGTTTAATTGG + Intergenic
1200940721 Y:8777436-8777458 CAAAATATTCATAGTTTAATTGG - Intergenic
1200955032 Y:8936140-8936162 CAAAATATTCATAGTTTAATTGG + Intergenic
1200958869 Y:8978984-8979006 CAAAATATTCATAGTTTAATTGG + Intergenic
1200985439 Y:9298249-9298271 CAAAATATTCATAGTTTAATTGG - Intergenic
1201039155 Y:9811766-9811788 CAAAATATTCATAGTTTAATTGG - Intergenic
1202183740 Y:22161431-22161453 CAAAATATTCATAGTTTAATTGG - Intergenic
1202207619 Y:22424970-22424992 CAAAATATTCATAGTTTAATTGG + Intergenic
1202233160 Y:22677376-22677398 CAAAATATTCATAGTTTAATTGG + Intergenic
1202309996 Y:23518782-23518804 CAAAATATTCATAGTTTAATTGG - Intergenic
1202560805 Y:26151811-26151833 CAAAATATTCATAGTTTAATTGG + Intergenic