ID: 965350201

View in Genome Browser
Species Human (GRCh38)
Location 3:167602197-167602219
Sequence TGGCCCCAAAGGACACCCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965350197_965350201 12 Left 965350197 3:167602162-167602184 CCACAAAGAATTGGACGGCTATT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 965350201 3:167602197-167602219 TGGCCCCAAAGGACACCCACTGG 0: 1
1: 0
2: 2
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965350201 Original CRISPR TGGCCCCAAAGGACACCCAC TGG Exonic
901207197 1:7503999-7504021 TGACCCCAAAGGGCAGCCAGAGG + Intronic
902977404 1:20098863-20098885 TGGCCCCCCAGGACTCCCACTGG + Intergenic
903743375 1:25571269-25571291 TGGCCCCAAAGGGCAGCCACTGG - Intergenic
903865260 1:26393032-26393054 TGGCCCCAAAGGTCAGCTTCAGG + Intergenic
904777211 1:32917757-32917779 TGGCCCCAAAGAGTACCCACAGG - Intergenic
906419760 1:45655450-45655472 TGGACCCTAAGGGTACCCACAGG + Intronic
907384183 1:54115237-54115259 TGGCCCCGAGGGAGAGCCACAGG + Intergenic
913532617 1:119743408-119743430 TGGCCACCAGGGACAGCCACAGG - Intronic
915080996 1:153352573-153352595 TGGGGCCAAAGGAATCCCACAGG + Intergenic
920757999 1:208753617-208753639 TGGGCCAAAAGGACAGCAACTGG + Intergenic
1066480376 10:35789625-35789647 TGCCCCCAGAGGTAACCCACTGG - Intergenic
1069596491 10:69675171-69675193 TTGCCCCAGTGGACAACCACTGG - Intergenic
1070812793 10:79306702-79306724 TGGCCACCAAGGTCACCCACTGG + Intronic
1071463001 10:85916201-85916223 TGGCTTCCAAGGACAGCCACTGG - Exonic
1072679699 10:97498329-97498351 AGGCCCCATAGGGCACCCATAGG + Exonic
1075105384 10:119536806-119536828 AGGCCCCAGAGGACACACAGGGG - Intronic
1075917735 10:126183717-126183739 TTTCCCCAAAGTACAACCACAGG + Intronic
1076693513 10:132236142-132236164 TGGCCCCAAAGCCCACACATGGG + Intronic
1076865081 10:133162517-133162539 AGACCCCTATGGACACCCACCGG + Intronic
1078636951 11:13060475-13060497 TAGCCCCAAAGCCCACCAACTGG + Intergenic
1079347691 11:19667441-19667463 TGCCCCCAAAGCACACCCACAGG - Intronic
1079688281 11:23389971-23389993 TGGCACCATTGGACATCCACAGG - Intergenic
1080025087 11:27604852-27604874 TGGCCCCAAAGCTCCCCAACTGG - Intergenic
1080267936 11:30421151-30421173 TGAACCCACAGGACACCCAGGGG + Intronic
1083328491 11:61885822-61885844 ATGCCTCAAAGGACACCCCCAGG + Intronic
1084408421 11:68992150-68992172 TGGCCCCAGAGGACCCCTCCCGG + Intergenic
1085339636 11:75722724-75722746 TGGCCTCAAAGGACAGCATCTGG + Intronic
1086368245 11:86130283-86130305 TCTCCCCAAAGGCCACACACGGG + Intergenic
1088604216 11:111512806-111512828 CGGCCCCCGAGGACACCCCCGGG - Intergenic
1090273546 11:125404277-125404299 TGGCGGCAAAGGCCACCCTCTGG - Intronic
1090848052 11:130546771-130546793 GGACCCCAAAGGACACCCCTGGG + Intergenic
1091631503 12:2164215-2164237 TGGCCCCAAAGAACACAGTCAGG - Intronic
1092069651 12:5622367-5622389 TGGCCCTAAAGCACAGGCACAGG - Intronic
1095094514 12:38138556-38138578 TGACCCCAAAGGCCACCACCGGG - Intergenic
1101259391 12:103013216-103013238 TGCCCCCAAAGCACACGCATTGG - Intergenic
1101837286 12:108304346-108304368 TGAGCCCATAGGACACACACCGG - Intronic
1102700923 12:114838740-114838762 AGGCCCCAGAGCACACCCAGGGG + Intergenic
1103987952 12:124779916-124779938 AGGCAGCACAGGACACCCACAGG + Intronic
1106308871 13:28535419-28535441 TGGCACCAAAGGGCACCTGCAGG - Intergenic
1106391076 13:29336518-29336540 TGTCCCGAAAGGGCACCCGCCGG + Intronic
1113521722 13:110946427-110946449 TGGCCCCACAGGAGAGCCAAAGG - Intergenic
1113823182 13:113230045-113230067 TGGCCACAGAGGACACACAGGGG - Intronic
1113885428 13:113656317-113656339 GGGCCCCAGAGCAGACCCACAGG - Intronic
1117339389 14:54780751-54780773 TGGTCCCAGAGGACCTCCACAGG + Intronic
1118706651 14:68486369-68486391 GGGCCCCAGAGGACAGCCAGTGG - Intronic
1118838089 14:69490747-69490769 TGGACACAAGGGACACACACTGG + Intronic
1120902940 14:89591411-89591433 TGGCCCCAGAGGAAAACCTCCGG + Intronic
1120977609 14:90263076-90263098 TAGCCCCAAATGACACACCCTGG - Intronic
1121182842 14:91942407-91942429 TGGCACCTGAGGACCCCCACGGG - Intronic
1122406772 14:101505469-101505491 TGGCCCCCACGGACAGTCACCGG + Intergenic
1125511193 15:40293290-40293312 TTGCCCCACTGGATACCCACTGG - Intronic
1125680401 15:41526994-41527016 TGCCCCCACAGGAGACCAACTGG + Exonic
1127914458 15:63443874-63443896 TGGCCCAAGAGGACCCTCACAGG - Intergenic
1128299935 15:66560253-66560275 TGGCCCCAAAGGACACTTAGCGG - Intronic
1130648954 15:85751428-85751450 TGGCCCGGGGGGACACCCACAGG - Intergenic
1130663750 15:85852245-85852267 TGGCCTGAAAGAAAACCCACAGG + Intergenic
1132579598 16:678935-678957 CGGCCCCACAGTACACCCTCAGG - Intronic
1132935903 16:2480942-2480964 GAGCCCCAAAGGACACTCACCGG + Intronic
1135410413 16:22230014-22230036 GGACCCCAGAGGAGACCCACGGG - Intronic
1137575156 16:49594665-49594687 TAGCCCAAAAAAACACCCACAGG + Intronic
1138233410 16:55358101-55358123 TGGCCCTAAAGAACACCTCCAGG + Intergenic
1141023414 16:80520142-80520164 TGCCCCCAAGGGGCACCGACTGG - Intergenic
1143993132 17:10984013-10984035 GGACCCCACAGGAAACCCACTGG - Intergenic
1144793017 17:17872083-17872105 AGGCGCCAATGGACACTCACAGG + Intronic
1145972431 17:28964237-28964259 TGGCCCCAAATGACACCTCCAGG - Intronic
1147966777 17:44198460-44198482 AGGCCTCAAAGCAAACCCACAGG + Intronic
1149011692 17:51863652-51863674 TGGTCCCCACGGACACCCTCAGG + Intronic
1149344926 17:55725219-55725241 TGTCCCCAAAGGATGCCCAGGGG - Intronic
1149406650 17:56358744-56358766 AGGCACCACAGGACACCCATGGG + Intronic
1150721726 17:67619469-67619491 GGCCCCCCAAGGACCCCCACAGG + Intronic
1151207255 17:72516928-72516950 TCGCCCCACAGGACACACACAGG + Intergenic
1151552648 17:74830973-74830995 GGGCCCCCGAGGACACCCATAGG - Intronic
1152865854 17:82722519-82722541 GGGCACCAGAGGACACACACAGG - Intronic
1157838549 18:50932274-50932296 TGGCCCAAATGGACTGCCACTGG - Exonic
1161680660 19:5678212-5678234 TGGCCCCAGAGCACAGCCTCTGG + Intronic
1161710254 19:5843679-5843701 TGGCCACAAAGGACTCCAGCAGG + Exonic
1163842653 19:19620716-19620738 TGGTCTCGAAGGAGACCCACGGG + Intergenic
1164929526 19:32164768-32164790 TGTCCCCAAAGACCCCCCACTGG + Intergenic
1164930329 19:32170372-32170394 TGGCACCAAAGGACCACAACAGG + Intergenic
1166009066 19:39927685-39927707 TGGCCAGAGAGGACAGCCACGGG + Exonic
1167475624 19:49699296-49699318 TGGCCCCAAAGAACAGACCCAGG + Intronic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
1168591869 19:57643022-57643044 TGGGCTCAAAGGACACCCTGAGG + Intergenic
927175714 2:20405818-20405840 TGGCCCCCCAGGAATCCCACTGG + Intergenic
929558100 2:42937867-42937889 TGGCCACAAATGACACCCCCAGG - Intergenic
930748465 2:54908719-54908741 TGCCCCAAAATGCCACCCACAGG + Intronic
937500579 2:122474333-122474355 GGGCACCAAAAGACACCCATTGG + Intergenic
940020511 2:149151595-149151617 TGGCACCTAAGGACATCCATCGG - Intronic
945411495 2:209514409-209514431 TGGCTGCAAAAGACAACCACTGG + Intronic
948112069 2:235464206-235464228 TGGCCCCAGAAGACACAGACAGG + Intergenic
948201512 2:236132844-236132866 TGCCGTCACAGGACACCCACAGG + Intergenic
1170861547 20:20108932-20108954 TTGCCACAAAGGACATCCTCAGG - Intronic
1170930049 20:20761504-20761526 AGGGCCCAAAGGAAACCCAGAGG - Intergenic
1172462865 20:35133277-35133299 AGGCACCAGAGGAGACCCACAGG + Intronic
1172887524 20:38241219-38241241 TGCCCCAGAAGTACACCCACTGG + Exonic
1175602659 20:60287598-60287620 TGGCCCCTTAGGCCAACCACGGG + Intergenic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1176545695 21:8197067-8197089 TGACCCCAACAGCCACCCACGGG - Intergenic
1176564646 21:8380112-8380134 TGACCCCAACAGCCACCCACGGG - Intergenic
1179156678 21:38857263-38857285 TGGCCCCACAGCAAACCCAGAGG - Intergenic
1179611938 21:42557633-42557655 CTGCCCCCAAGGCCACCCACTGG + Intronic
1180908173 22:19430789-19430811 TGGCTCCAAAGCACACCCTTGGG - Intronic
1181978725 22:26751362-26751384 TGACCCCAGATGACCCCCACAGG - Intergenic
1182466495 22:30520061-30520083 TGGCTGCCAAGGACAGCCACTGG - Intergenic
1183678968 22:39315833-39315855 CTGACCCAAAGGACAGCCACAGG - Intronic
1183696804 22:39428225-39428247 TGGTGCCACAGGACACACACGGG - Intronic
1183979638 22:41532004-41532026 AGGCCCCAAAGGCCACCCTAAGG + Intronic
1184108256 22:42381152-42381174 TGGTCCCACAGGACAGCCAGTGG + Exonic
1184108804 22:42383541-42383563 TGGTCCCACAGGACAGCCAGTGG - Exonic
1184234620 22:43176393-43176415 TGGCCTAAAAGGAAACACACCGG + Exonic
1203250566 22_KI270733v1_random:113304-113326 TGACCCCAACAGCCACCCACGGG - Intergenic
950442081 3:13016077-13016099 TGGGCCCAAAGGGGACCCAGGGG + Intronic
952979940 3:38726575-38726597 TATCCCCAAGGGACAGCCACAGG - Intronic
954288667 3:49637343-49637365 TGGCCCCAAAGGATGCTCACAGG - Intronic
954327976 3:49873908-49873930 TGGCCCCACTTGACACCTACCGG - Intergenic
954698613 3:52440403-52440425 TGCCCCCATAGGGCCCCCACTGG + Exonic
957378549 3:79392697-79392719 TTGCCCCAGAGGAGAACCACAGG - Intronic
962454071 3:135549064-135549086 TGGCCCCACATGGCATCCACTGG + Intergenic
964389881 3:156185869-156185891 TGCCCCCAAAAGGCACCAACTGG - Intronic
965350201 3:167602197-167602219 TGGCCCCAAAGGACACCCACTGG + Exonic
965793129 3:172411048-172411070 TGGCACCAAAGGGCACCTGCAGG + Intergenic
968904041 4:3443555-3443577 TGGCCCTAAGTGGCACCCACCGG - Intronic
969929992 4:10621461-10621483 TTGACTCAAAGGACACCCACTGG - Intronic
976947495 4:90788547-90788569 TGGACACAAAGGACACCTACAGG - Intronic
977209021 4:94196231-94196253 TGCCCCCAAAGGCCACCATCTGG - Intergenic
979874215 4:125866839-125866861 TCGCATGAAAGGACACCCACAGG + Intergenic
980304871 4:131046707-131046729 TGGCCTCAAAGGACACAGAAGGG + Intergenic
981110890 4:140932059-140932081 TGGTGCCAAAGGAAAACCACAGG - Intronic
982769713 4:159385760-159385782 TGGCCTCAAAGGAGACCTACTGG + Intergenic
984568808 4:181365234-181365256 TGTCCCCAAAGGAGAGCAACTGG - Intergenic
992863061 5:80931600-80931622 TGGCTCCAAAGGACAGCCTGAGG + Intergenic
1001527002 5:172436258-172436280 TGGCCCAAAAGCCCACCCACGGG - Intronic
1002278041 5:178115717-178115739 TGACCCAAAAGGGCACCAACAGG + Intronic
1003244809 6:4374755-4374777 TGGTCAGAGAGGACACCCACAGG - Intergenic
1005016785 6:21382105-21382127 TGGCCCCAAAAGAAATCAACTGG + Intergenic
1008274053 6:49523030-49523052 AGGTCCCCAAGAACACCCACAGG + Intronic
1009943097 6:70312329-70312351 TGGCACCAAAGGGCAACCACAGG + Intergenic
1013368055 6:109449565-109449587 TGACCCCAAAGGGCAGCGACTGG + Intronic
1016425923 6:143935408-143935430 TGGCACCAATGGACACTGACTGG - Intronic
1018784101 6:167094382-167094404 TGGCCTCAACGGAAGCCCACTGG - Intergenic
1018940795 6:168308005-168308027 TGGCCCCGCAGGAGAGCCACCGG - Exonic
1019522291 7:1466388-1466410 AGGCCCAAAAGGACACCCCATGG - Intergenic
1019919069 7:4151269-4151291 TGGCCCCAGAGGACCCACCCTGG + Intronic
1022570478 7:31448311-31448333 TCACCCCACAGGACACCCAGGGG + Intergenic
1026807693 7:73438159-73438181 TGGCCTCAAAGCACAGCCCCCGG - Intergenic
1029680452 7:102105096-102105118 TGTCCCCAGAGGACACACACTGG - Intronic
1030050494 7:105532739-105532761 GGCTCCCAAAGGGCACCCACTGG - Intronic
1030089313 7:105843450-105843472 TGGCCCCAAATGCCAGCCAATGG + Intronic
1032034366 7:128510829-128510851 TGGCCCCAAAGGCATCCAACTGG - Intergenic
1034399259 7:150851040-150851062 ATGCTTCAAAGGACACCCACAGG - Intronic
1034496810 7:151427970-151427992 TGGTCGCACAGGAGACCCACAGG + Intergenic
1034680219 7:152922870-152922892 TGGCCCTAATTGATACCCACGGG - Intergenic
1034996747 7:155582175-155582197 TGGCACCCAAGGACCCCCTCAGG - Intergenic
1035602596 8:905602-905624 TGACCCTAAAGGAGTCCCACAGG + Intergenic
1036621616 8:10427804-10427826 TGGCCCCAAAGCTCTCCCAGGGG - Intronic
1037581161 8:20246792-20246814 TGTCCCCAAAGGACGCCTGCAGG - Exonic
1037983189 8:23269726-23269748 TGGCACCAGAGCCCACCCACTGG - Intergenic
1039432550 8:37536226-37536248 TGGGTCCAAAGAAGACCCACTGG + Intergenic
1041325294 8:56656881-56656903 TGGGCACAAAGGAAACCAACAGG - Intergenic
1042747350 8:72121767-72121789 TATCCCCAAAGGACAACCAAGGG - Intergenic
1049197509 8:141323830-141323852 TGGCTCTCAAGGACCCCCACTGG - Intergenic
1049780418 8:144426238-144426260 TGGCCCCAAAGGGAACCCAAGGG + Intronic
1052542128 9:29825146-29825168 TGGCCCAAATGGACTGCCACTGG + Intergenic
1054810048 9:69427303-69427325 TGTGCTCAAAGGAGACCCACAGG + Intergenic
1057351284 9:94300813-94300835 AGGCACCAGAGGACACACACAGG + Exonic
1060209670 9:121701907-121701929 TGGCTCCATGGGACCCCCACTGG + Intronic
1060236798 9:121869851-121869873 TTGCCCCAAAGTGCCCCCACAGG + Intronic
1060551197 9:124486205-124486227 TGCCCCCAGAGGTCAGCCACAGG + Intronic
1062700081 9:137895061-137895083 TGGTGCCACTGGACACCCACAGG - Intronic
1203466968 Un_GL000220v1:96576-96598 TGACCCCAACAGCCACCCACGGG - Intergenic
1187241057 X:17513675-17513697 TGGCCCCAGTTGAGACCCACTGG - Intronic
1191264841 X:58377103-58377125 TGGCCACAAGGGGCTCCCACTGG + Intergenic
1197066309 X:122237687-122237709 TGGCACCACAGGAAACCAACAGG - Intergenic
1198975121 X:142327626-142327648 TGGCCACCATGGACACGCACCGG - Intergenic