ID: 965356457

View in Genome Browser
Species Human (GRCh38)
Location 3:167680200-167680222
Sequence TTGTAGGTATCCAACTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965356457_965356461 -9 Left 965356457 3:167680200-167680222 CCAGTGAAGTTGGATACCTACAA No data
Right 965356461 3:167680214-167680236 TACCTACAACAGATGGGAATGGG No data
965356457_965356462 -8 Left 965356457 3:167680200-167680222 CCAGTGAAGTTGGATACCTACAA No data
Right 965356462 3:167680215-167680237 ACCTACAACAGATGGGAATGGGG No data
965356457_965356460 -10 Left 965356457 3:167680200-167680222 CCAGTGAAGTTGGATACCTACAA No data
Right 965356460 3:167680213-167680235 ATACCTACAACAGATGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965356457 Original CRISPR TTGTAGGTATCCAACTTCAC TGG (reversed) Intergenic
No off target data available for this crispr