ID: 965357036

View in Genome Browser
Species Human (GRCh38)
Location 3:167688444-167688466
Sequence TTTTTTCTTTAGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1289
Summary {0: 1, 1: 0, 2: 12, 3: 116, 4: 1160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965357036 Original CRISPR TTTTTTCTTTAGAAAGGGGA GGG (reversed) Intronic
900696002 1:4010793-4010815 TTTTTTCTTTCAAAAGCGGCTGG + Intergenic
901233980 1:7657548-7657570 TTGCTGCTTTAAAAAGGGGAAGG + Intronic
901593671 1:10367732-10367754 TTTGTTTTTTGGAGAGGGGATGG + Intronic
901859582 1:12065385-12065407 TTTTTATTTTAAAAAGGGTATGG - Intronic
901985350 1:13071253-13071275 TTTTTTTTTGAGGATGGGGATGG + Intronic
901996460 1:13155517-13155539 TTTTTTTTTGAGGATGGGGATGG - Intergenic
902160309 1:14524458-14524480 TTTTGTTTTTAGAAATGAGACGG - Intergenic
902275533 1:15336969-15336991 TTTCTTCATGAGAAAGGAGATGG - Intronic
902669553 1:17963406-17963428 TTTTTTTTTAAGGTAGGGGAGGG + Intergenic
903241001 1:21982583-21982605 TTTTTTTTTGAGACAGGGTATGG - Intronic
903400954 1:23047894-23047916 TTTTTTTTTTGGCAGGGGGAAGG - Intronic
903526889 1:23997497-23997519 TTTTTTTTTTAGAGATGGGGGGG + Intergenic
903631428 1:24775836-24775858 TTTTTTCTTGAGAATGGGTCAGG + Intronic
903704620 1:25276520-25276542 TTTTTTTTTTAGAGATGGGGGGG - Intronic
904080624 1:27870251-27870273 TTTTTTTTTTTGAGAGGGGTGGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904506309 1:30957765-30957787 ATTTTTCTTTAAAAGTGGGAAGG - Intronic
905699673 1:40001974-40001996 TTTTTTTTTTAAAAAAAGGAGGG - Intergenic
905759339 1:40541197-40541219 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
906027455 1:42685635-42685657 TGTTTTCTGTATAAAGGAGAGGG + Intronic
906118740 1:43373273-43373295 TCTCTTCTTGAGAAAGAGGATGG - Intergenic
906253699 1:44331308-44331330 TTTTTTTTTAAGCAGGGGGAAGG + Intronic
906632606 1:47385079-47385101 TTTTTTTTTTAAAAAGGACAGGG + Intergenic
907680834 1:56561860-56561882 TTTTATTTTTAGTAAGGGCAGGG - Intronic
907682822 1:56579713-56579735 TTTTTTTTTTTGAAGGGGGTGGG - Intronic
908218440 1:61979218-61979240 ATTTTTATTTAGAAATGGGAGGG + Intronic
908598935 1:65718540-65718562 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
908633821 1:66139724-66139746 TTTTTTTTTTTGAGGGGGGAGGG - Intronic
908790221 1:67773738-67773760 TTTTTCTTTTAGAACAGGGATGG + Intronic
908930631 1:69312764-69312786 ACTTTGGTTTAGAAAGGGGATGG + Intergenic
909298045 1:73976199-73976221 TTTTTTCTTTGGTAGGGGGGTGG + Intergenic
909854322 1:80508821-80508843 TTTTTACTCAAGAAAGAGGAAGG - Intergenic
910112138 1:83694069-83694091 TTTTTTTTTTAGACAGGGAGGGG + Intergenic
910555220 1:88524019-88524041 ATTTTTCTTTAGAAATGTTAAGG - Intergenic
910894370 1:92052428-92052450 CTTTGGCTTTGGAAAGGGGATGG - Intronic
911114516 1:94232937-94232959 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
911214955 1:95182831-95182853 TTTTTTTTTTAAGAAGTGGATGG + Intronic
911456950 1:98137275-98137297 TTCTTTCTTTATAAAGGAAAAGG + Intergenic
911536472 1:99106195-99106217 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
911630121 1:100174307-100174329 TTTTTTTTTTAGACAGGGTCTGG + Intronic
912098619 1:106177443-106177465 TTTTTTTTTTAAGAAAGGGAAGG + Intergenic
912309236 1:108602860-108602882 TTTTTTTTTGAGACAGGGTATGG - Intronic
912413236 1:109491845-109491867 TGTTTTCTTTAGGAAGAGGTAGG + Intronic
913323079 1:117603999-117604021 TTTTTAATTTAAAAAGGGGGGGG - Intergenic
913664862 1:121037999-121038021 TTTCTTCTTTAGCAAGTGGCAGG - Intergenic
914016255 1:143821274-143821296 TTTCTTCTTTAGCAAGTGGCAGG - Intergenic
914393051 1:147239194-147239216 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
914654872 1:149729815-149729837 TTTCTTCTTTAGCAAGTGGCAGG - Intergenic
914688172 1:150001078-150001100 TCATTTCTTGAGAAAGAGGAAGG + Intronic
914726326 1:150330663-150330685 TTTTTTATGGAGAATGGGGATGG + Intronic
915046569 1:153022326-153022348 ATCTTGGTTTAGAAAGGGGAGGG - Intergenic
916254585 1:162773676-162773698 TTTTTTCTTTTGAGATGGGAAGG + Intronic
916277319 1:163008776-163008798 ATATTTTTTTAGAAAGGGGGAGG + Intergenic
916441740 1:164833183-164833205 TTGTTTTTTTAGCGAGGGGAGGG - Intronic
916688624 1:167170427-167170449 TGGTGTCTTTAGAAAGGAGAGGG - Intergenic
916787896 1:168099324-168099346 TTGTTTCTTTTGAAAAGTGAAGG - Intronic
917168340 1:172139930-172139952 TTTTTGTTTTTAAAAGGGGAGGG - Intronic
917646685 1:177035707-177035729 TTTTTTCATCAGAAAAGGAAGGG - Intronic
917742074 1:177970362-177970384 CTTTTTCTTTAAAATGGGAATGG + Intronic
917787536 1:178474895-178474917 TTTTTTCTAGAAAAAGGGGATGG + Intronic
917882900 1:179356858-179356880 TTTTTTTTTTAGAGATGGGGGGG + Exonic
918094467 1:181323167-181323189 TTGGTTCATGAGAAAGGGGAAGG - Intergenic
918654810 1:187011269-187011291 CTTTTTTTTTTTAAAGGGGATGG + Intergenic
919008526 1:191929615-191929637 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
919034911 1:192294117-192294139 TTTTTTTTTTGGCAGGGGGAGGG + Intergenic
919258823 1:195162642-195162664 TTTTTTTTTTAGTGGGGGGAGGG + Intergenic
919369883 1:196709711-196709733 TTTTATCTATAGAAAGGAAAAGG - Intronic
919458568 1:197848837-197848859 TTTTTTTTTTAGATAGGGTCTGG + Intergenic
919734091 1:200934515-200934537 TTTTCTCTTTAGAAACGAGAAGG + Intergenic
919816424 1:201443670-201443692 TTTTTTTTTCAGAAGGGGAAAGG - Intergenic
920165711 1:204034245-204034267 TTTTTTTTTTAGACAGAGGCTGG - Intergenic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
920744970 1:208617562-208617584 CTTTGCCCTTAGAAAGGGGAGGG + Intergenic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
920887473 1:209944758-209944780 TTTTTTCTTTAAAAAAGAGAGGG - Intronic
920962438 1:210675470-210675492 TTTTTTTTTTGGAGTGGGGAAGG + Exonic
921326568 1:213990121-213990143 TTTTTTTTTTAAATAAGGGAGGG - Intronic
921607880 1:217176572-217176594 TTTTTTTTTTTGGAAGGGGGTGG - Intergenic
921966985 1:221100543-221100565 TTTTTTATTTAAAAAATGGAAGG + Intergenic
922097444 1:222454540-222454562 GTCATGCTTTAGAAAGGGGAGGG - Intergenic
922288703 1:224192197-224192219 TTTTTTTTTAAGAGAGAGGAGGG + Intronic
922579178 1:226684486-226684508 TTTTTTCTTTAACCAGGGAAGGG + Intronic
923168779 1:231393768-231393790 TTTTTTTTTCTGAAAGGGAAAGG - Intronic
923169024 1:231396023-231396045 TTTTTTCTTTTTAAAGGAGTGGG - Intronic
923337508 1:232983225-232983247 TATTGTCTTTTGAAAAGGGATGG + Exonic
923445464 1:234066614-234066636 TTTTATCTTTGGGAAGGAGAAGG - Intronic
923484887 1:234419629-234419651 TTTTTTTCTTAGAATGGAGAGGG - Intronic
923859765 1:237881825-237881847 TTTTTTTTTTTTAAAGGGGGTGG - Intronic
924064683 1:240209253-240209275 TTTTTTTTTTGGAGGGGGGACGG + Intronic
924065594 1:240218550-240218572 TTTTTTTTTTAGAGATGAGATGG - Intronic
924122876 1:240820459-240820481 TTTTTTTTTTAGGCAGGGGGTGG + Intronic
924189656 1:241537257-241537279 TTCTTTTTTTAGAAAGGAGTAGG - Intronic
924674919 1:246166088-246166110 TTTTTTTTTTAAAAAAGGGAGGG - Intronic
924674940 1:246166280-246166302 TTTTTTCTTTAGGACTGTGAAGG - Intronic
1063005617 10:1967816-1967838 TTATTTCCTTATAAAAGGGAAGG - Intergenic
1063421184 10:5913641-5913663 TTTTCTTTTTAGAAATGGGAAGG + Intronic
1064538996 10:16387286-16387308 TTTTTTTTTTTGCAGGGGGAAGG + Intergenic
1065060772 10:21898824-21898846 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1065094629 10:22268145-22268167 TTTTTTCTTGAGACAGGATATGG - Intergenic
1065381472 10:25095755-25095777 TTCTTCCTTTGGAAAGGGGAGGG - Intergenic
1066054334 10:31666502-31666524 TTATTTCATGAGAGAGGGGAGGG - Intergenic
1066094396 10:32058264-32058286 TTTTTTTTTGAGACAGGGTATGG - Intergenic
1066332288 10:34437651-34437673 TTTTTTCTTTAGAGAGTCCAGGG - Intronic
1066658416 10:37716616-37716638 TTTTTTCATTTGAAAGTAGAAGG + Intergenic
1067042916 10:42966301-42966323 TTTTTTCATTTGAAAGTGGAAGG + Intergenic
1067117771 10:43448507-43448529 TTTTTTCTTTTTTAAGGAGATGG + Intronic
1068703012 10:60040127-60040149 TTTTCTCTTTAAAAATAGGATGG + Intronic
1068709819 10:60121677-60121699 TTTTTTTTTGAGAAAGGGTCTGG - Intronic
1068725533 10:60297237-60297259 TTTTTTCTTTAGTCAAGTGACGG - Intronic
1068814861 10:61297779-61297801 TTTTTTCATGAGACAGGAGAAGG + Intergenic
1069397163 10:68002056-68002078 TATTTGCATTAGAATGGGGAAGG - Intronic
1069420888 10:68245508-68245530 TTTTTTTTTTAAAAAAAGGAGGG + Intergenic
1069933516 10:71899805-71899827 CTCTGCCTTTAGAAAGGGGAGGG - Intergenic
1070075347 10:73129665-73129687 TTTTTTTTTTTTAAAGGGTAAGG - Intronic
1070489266 10:76960525-76960547 TTTTTTTTTTAGACAGGGTCTGG - Intronic
1071052280 10:81465653-81465675 TTTTTTTTTTTGGATGGGGATGG + Intergenic
1071309881 10:84332784-84332806 TTTTTTCTTTAAAATAGAGATGG - Intronic
1073071625 10:100798119-100798141 TTTTTTTTTTAGACAGGGTCAGG + Intronic
1073325721 10:102643317-102643339 TTTTTTTTTTTCCAAGGGGAGGG - Intergenic
1073687515 10:105771654-105771676 TTTTTTCTTTATAAAGACCATGG - Intergenic
1074026359 10:109640079-109640101 TTTTATTTTTATTAAGGGGAAGG + Intergenic
1074097678 10:110328373-110328395 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1074135711 10:110624890-110624912 TTTTTTTTTTAGAGAGGCAAGGG - Intergenic
1074226857 10:111493444-111493466 TTCTGGCTTTAGAAAGGGAAGGG - Intergenic
1074248722 10:111722198-111722220 TTATTTGATTAGAAAGGGTAAGG - Intergenic
1074515372 10:114163676-114163698 TTTTTTCTTTACAGAGCTGAAGG - Intronic
1074571747 10:114631016-114631038 TTTTATCTCTAGAGAGGAGAGGG + Intronic
1075131573 10:119744319-119744341 TCTTTGTTTTAGCAAGGGGAAGG - Intronic
1075139585 10:119819232-119819254 TTTTTTTTTTTTAAAGGGGAAGG + Intronic
1075750150 10:124762003-124762025 TTTTTTCTTGAGGCAGGGGTGGG + Intronic
1075795711 10:125118112-125118134 ATTTTTCTTTAAAAAGTGGCAGG - Intronic
1076037509 10:127212798-127212820 TTTTTTTTTTGGCAAGGGGTGGG - Intronic
1076048829 10:127316017-127316039 TTTTTTCTTTTTAAAGAGTAAGG - Intronic
1076061217 10:127415701-127415723 TTATTTCTTTAAAAAGGGTCAGG - Intronic
1077137568 11:1008789-1008811 TTTTTTCTTTAAAAAGGCAAAGG - Intronic
1077593290 11:3509484-3509506 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1077776324 11:5275898-5275920 TTTTTTCTTTAGACTTGGGATGG + Intronic
1078002057 11:7504937-7504959 TTTTTTTTTTAGACAGGGTCTGG + Intronic
1078234474 11:9471554-9471576 TTTTTTTTTTTGAAACGGGACGG + Intronic
1078281690 11:9908702-9908724 TTGTTGTTTTAGAAAGGGCAGGG + Intronic
1078362336 11:10678989-10679011 TTTCTTCCTGAGAAAGGGAAGGG - Intronic
1078628403 11:12979599-12979621 TTTTTTTTTTAGTGAGAGGAAGG - Intergenic
1078954888 11:16181547-16181569 TTTTTTTTTTGGAAGGGGAAAGG - Intronic
1079014562 11:16857525-16857547 TTCTGTCTGGAGAAAGGGGATGG - Intronic
1079062595 11:17262460-17262482 TTTTTCCTTTAGAAAGAGAATGG - Intronic
1079162388 11:18007257-18007279 TTTTTTCTTTACAAAGGAAGAGG + Intronic
1079183562 11:18215411-18215433 CTTTGCCTTTAAAAAGGGGAGGG + Intronic
1079798705 11:24841613-24841635 TTCTTTCTTGAGAAATTGGAAGG - Intronic
1079929212 11:26537013-26537035 TTTTTTTTTTTGGTAGGGGACGG + Intronic
1079954874 11:26850056-26850078 TTTCTTCTTTATAAAGAGCAAGG - Intergenic
1080555188 11:33409703-33409725 TTTTAAATTGAGAAAGGGGATGG - Intergenic
1081122365 11:39283360-39283382 ATTTTTCTTTGGAAAAGTGAGGG - Intergenic
1081492836 11:43580801-43580823 CTTTTTTTTCAGAAGGGGGAGGG - Intronic
1081628795 11:44673352-44673374 TATTTTGTTTAGAAAGGGGGGGG - Intergenic
1081847247 11:46249558-46249580 TCTGTTATTTAAAAAGGGGATGG - Intergenic
1082022188 11:47543749-47543771 TTTTTTTTTTAGAGACGGGGTGG - Intronic
1082038712 11:47667156-47667178 GTTTGTCTTTAGAAAGCAGAGGG + Intronic
1082061938 11:47868336-47868358 TTTTTTTTTGAGAAAGGGTCTGG - Intergenic
1082599871 11:55136122-55136144 TTCCTTCTTTAGAATTGGGAGGG - Intergenic
1082982932 11:59140499-59140521 TTTTTTCTTTTGAAAAGGTAGGG + Intergenic
1083121506 11:60517483-60517505 TTTTCCCATTGGAAAGGGGAAGG - Intronic
1084168429 11:67388268-67388290 TTTTTTTTTGAGAAAGGGTCTGG + Intronic
1084249118 11:67882202-67882224 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1084823690 11:71713268-71713290 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1084986409 11:72876980-72877002 TTTTTTTTTTAGACAGGGTCTGG + Intronic
1085557115 11:77434447-77434469 TTTTTTTTTTGGAGAGGGGATGG + Intronic
1085567209 11:77525171-77525193 TTTTTTTTTTTGATAGGGGTGGG - Intronic
1085670548 11:78460275-78460297 TTTTTTTTTTTTAATGGGGATGG + Intronic
1085717626 11:78887022-78887044 TTTTTATTTTAGAAAGGTAAGGG - Intronic
1085964096 11:81499506-81499528 CGTTTTCTTTAAAAAGGGGAGGG - Intergenic
1086213653 11:84350936-84350958 TTTTTACATTGAAAAGGGGAGGG - Intronic
1086396833 11:86423888-86423910 ACTTTGGTTTAGAAAGGGGAAGG - Intergenic
1086453495 11:86939765-86939787 TTTTTTTTTTTTAAAGGGGTGGG + Intronic
1086524671 11:87711362-87711384 TCCTTCCTTTGGAAAGGGGAGGG + Intergenic
1086605325 11:88689147-88689169 TTTTGTTTTTACAAATGGGAAGG - Intronic
1086793478 11:91070576-91070598 TTTTTTTTTTACAAAGGACATGG - Intergenic
1087037234 11:93767749-93767771 TTTTTTTTTGAGAGAGGGTATGG + Intronic
1087048154 11:93861729-93861751 TTTTTTCATTGGAAAGTGCAAGG + Intergenic
1087082422 11:94184444-94184466 ATTTTATTTTAGAGAGGGGAAGG + Intergenic
1087556288 11:99725297-99725319 TTTTTGTTTTTGAAAGGAGAAGG + Intronic
1087926318 11:103922750-103922772 TTTTTTTTTTAGAGATGGGGGGG + Intronic
1088207265 11:107407388-107407410 TTTTTTTTTTGGTAGGGGGAAGG - Intronic
1088233843 11:107701366-107701388 TTCTTTCTTTAGCAGGGGAAAGG - Intergenic
1088268683 11:108011631-108011653 TTTTTTTTTTTGGAGGGGGACGG + Intronic
1088541821 11:110921029-110921051 CTTTTGCTGAAGAAAGGGGAAGG - Intergenic
1088856587 11:113760679-113760701 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
1088928986 11:114329954-114329976 TTTTTTTTTTGGCGAGGGGATGG - Intergenic
1088974670 11:114805196-114805218 TTTTTTTTTTAAAAAAGGTAGGG + Intergenic
1089166748 11:116483379-116483401 TTTTTTTTTTAGAAAAAGGCGGG - Intergenic
1089874099 11:121703517-121703539 CATTTTCACTAGAAAGGGGAGGG + Intergenic
1090337988 11:125987159-125987181 TTTTAACTTTAGCAAGGGGTTGG - Intronic
1090480076 11:127060096-127060118 TTTTTTCCTAAGCGAGGGGAGGG + Intergenic
1090505396 11:127306942-127306964 TTTTTTTTTTTGAAGGGGGAAGG - Intergenic
1090938747 11:131369263-131369285 TTTTTTCTTGAGACAGGGGCTGG + Intergenic
1091916397 12:4273958-4273980 TTTTGTTTTTTGGAAGGGGAGGG - Exonic
1092419409 12:8317624-8317646 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1092593340 12:9972788-9972810 ATTTTTTTTTAGAAAGAAGAAGG + Intronic
1092615816 12:10214363-10214385 TTTTTTCTTTTTAAAGGAAAAGG - Intronic
1093047674 12:14468261-14468283 TTTTTTTTTTTGAGATGGGATGG - Intronic
1093099211 12:15006952-15006974 TTTTTTATTTATAAAATGGATGG - Intergenic
1093336521 12:17912057-17912079 TGCTTTGTTTAGAGAGGGGAAGG + Intergenic
1093463912 12:19430998-19431020 TTTTTTTTTTAGACAGGGTCTGG - Intronic
1093762991 12:22931217-22931239 TTTTTTCTTTTAAAATGGGAAGG + Intergenic
1094021939 12:25924114-25924136 TTTTTTTTTTAGAAATGTGAAGG + Intergenic
1094380761 12:29840676-29840698 TTTCTACTTGAAAAAGGGGAAGG - Intergenic
1094569777 12:31631652-31631674 ATTTTTATTTAGAAAGTGGCAGG - Intergenic
1095265313 12:40149782-40149804 TTTTTTCTTTATAAATTGGATGG - Intergenic
1096000432 12:48125313-48125335 TTTTTTTTTAAGAGATGGGACGG + Intronic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1096109213 12:49019253-49019275 TTTATTTTTTAAAAAGGGGGAGG + Exonic
1096200981 12:49682778-49682800 TTTTATCTTTTGAAGGGGCAAGG - Intronic
1096497037 12:52044536-52044558 TTTTTTTTTGAGAACTGGGAAGG - Intronic
1096598279 12:52711586-52711608 TTTTTTTTTGAGACAGGGCAGGG + Intergenic
1096730298 12:53605730-53605752 TTTTCTGACTAGAAAGGGGATGG + Intronic
1097048030 12:56202115-56202137 TTTTTTTTTTAGATAGGGTCTGG - Intergenic
1097113865 12:56682705-56682727 TTTTTTCTTTTAAATGGAGACGG - Intronic
1097407643 12:59210802-59210824 TTTTTTTTTTGGAAATGGGATGG + Intergenic
1097608411 12:61784689-61784711 TTTTTTTTTGAAAAATGGGAGGG - Intronic
1097827660 12:64190734-64190756 TTTTTTTTTTTGAAAAGGCAAGG - Intronic
1098036347 12:66306582-66306604 TTTTTTCCTTTGAAAGAGAAAGG - Intronic
1098056223 12:66508491-66508513 TTTTTCCTTTTGAGAGAGGAAGG - Intronic
1098448876 12:70596506-70596528 TTTTTTTTTAAGAAAGTGAAAGG - Intronic
1098558112 12:71841928-71841950 TTTTTCTTTAGGAAAGGGGATGG + Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1098819358 12:75208912-75208934 GTTTTTCTTGGGAAGGGGGATGG - Intronic
1098971451 12:76861372-76861394 TTTTTTTTTTAAAAAAAGGAGGG + Intronic
1099426027 12:82523511-82523533 CTTTTCCTTGAGAAAAGGGAGGG + Intergenic
1099546695 12:83991249-83991271 GTTTTTCTGTAGAAAGATGATGG + Intergenic
1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG + Intergenic
1099984748 12:89649472-89649494 TTTTCCCTTTTGAAATGGGAAGG + Intronic
1100062108 12:90592327-90592349 TTTTGTCTTTAGGAATGGTAAGG + Intergenic
1100172425 12:91990712-91990734 TTTTTTCTGAAGCAAGGGAAAGG - Intronic
1100245374 12:92752017-92752039 TTTTTTTTTTTTAAGGGGGATGG - Intronic
1100405084 12:94265857-94265879 TTCTTTCTTTAGGAAGAGCATGG - Intronic
1100560669 12:95746392-95746414 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1100797748 12:98200052-98200074 TTTTCTCCTGAGAAAGGGAAGGG - Intergenic
1100818832 12:98412129-98412151 TTTTTTTTTTAGATAGAGTAGGG - Intergenic
1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG + Intronic
1101428201 12:104605140-104605162 TTTTTTTTTTGGAGAGGGGATGG - Intronic
1101555139 12:105801796-105801818 TTTTTTCTTTAGAAAAGGAAAGG + Intergenic
1101761366 12:107661480-107661502 TTTTTTTTTTTGAAAGAGGAAGG - Intergenic
1101780644 12:107832097-107832119 CATTGTCTTTGGAAAGGGGAGGG - Intergenic
1102424823 12:112834954-112834976 TTATTTGTTTAGAAAGGGAGAGG + Intronic
1102833640 12:116032295-116032317 TTTTTTCTTTAAAATTGGGTTGG - Intronic
1102859548 12:116323489-116323511 TTTTTTTTTGAGATGGGGGATGG - Intergenic
1102909106 12:116699115-116699137 TTTTTTCTTTAGATAGAGATAGG + Intergenic
1103102806 12:118194659-118194681 TTCTTTTTTTAAAGAGGGGATGG + Intronic
1103248958 12:119483421-119483443 CTTTATCTTTAAAAAGGGAAGGG + Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103857013 12:123978146-123978168 TTTATTCTTTAGGAAGAGAAGGG + Intronic
1104093349 12:125534098-125534120 TTTTTTCTTTATTAAGGGCTAGG + Intronic
1104339114 12:127930698-127930720 TTTTTTCTTTAGACAGAGTCTGG + Intergenic
1104996561 12:132661487-132661509 TTTGTGCTTTAGAAAGGACATGG - Intronic
1105257483 13:18753701-18753723 ACTTTGGTTTAGAAAGGGGAAGG - Intergenic
1105260143 13:18773016-18773038 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1105377750 13:19860991-19861013 TTTTTTCTTAAGACAGGGTATGG + Intronic
1105380407 13:19881812-19881834 TTTTTTATTTAGAATAGAGACGG - Intergenic
1105466446 13:20646305-20646327 TTTTTTTTTGAGACAGAGGACGG + Intronic
1105510188 13:21045263-21045285 TTTTTTTCCTAGAAATGGGAGGG - Intronic
1105949907 13:25220410-25220432 TTTTTTTTTTGGAGGGGGGACGG - Intergenic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106092879 13:26614079-26614101 TTTTTTCTTTTGGAAGGATAGGG + Intronic
1106185700 13:27407951-27407973 TTTTTTCTCTAGAAGAGGGGAGG + Intergenic
1106447345 13:29848746-29848768 TGTTTTGTTTATAAAGGGTAAGG - Intronic
1106704895 13:32269685-32269707 TTTTTTTTTTAAAATGGAGATGG - Intronic
1106994964 13:35470926-35470948 GTTTTTCTTTGGAAAGGGAGAGG - Intronic
1107232210 13:38123759-38123781 TTTTTTCTTTATAAAGATGGGGG + Intergenic
1108962104 13:56247216-56247238 CTTTATCTGTGGAAAGGGGAGGG - Intergenic
1108967935 13:56335440-56335462 TCATTTCTTCAGCAAGGGGAGGG + Intergenic
1109685894 13:65819184-65819206 CTCTTTCTTTGGAAAGGGGAGGG + Intergenic
1110639078 13:77800883-77800905 TTTTTACTCTGGAAAGGGGAAGG + Intergenic
1110670018 13:78166978-78167000 TTATTTCCTTAGAAAGATGATGG - Intergenic
1110700096 13:78536994-78537016 TTTGGTCTTTAGAAAGGGCAGGG + Intergenic
1111071126 13:83169721-83169743 CTTTTTATTTAAAAAGGAGATGG - Intergenic
1111124012 13:83889472-83889494 TTTTTTTTTTTGACAGGGCAAGG - Intergenic
1111782053 13:92740779-92740801 TTTTTTCTAAAGCAAGGGGTAGG + Intronic
1112044775 13:95585337-95585359 ATCTTTCTTTAGGAAGGGCATGG - Intronic
1112404758 13:99109059-99109081 TTTTTTTTTTAGACAGGGTCTGG - Intergenic
1112551725 13:100427758-100427780 TTTTTCCTTGTGAAAGGGGATGG + Intronic
1112618821 13:101034418-101034440 CTTTGCCTTTGGAAAGGGGAAGG - Intergenic
1112707001 13:102081575-102081597 TTTTTTTTTTAAAAAGAGCAGGG - Intronic
1112729577 13:102345523-102345545 TTTTTACTTTAGAAAGGGATGGG - Intronic
1112834422 13:103496781-103496803 TTTTTTTTTTAGCAGGGTGAGGG + Intergenic
1113022510 13:105903923-105903945 TTTTTTTTTGAGACAGGGTATGG - Intergenic
1113344590 13:109464577-109464599 TTATTTATTTAGAAAAGGGCAGG - Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113450725 13:110407544-110407566 TTTTTACATTAGAAAGGAGTCGG + Intronic
1113529388 13:111010178-111010200 TTTTTTTTTTAATAAGGAGAAGG - Intergenic
1113837978 13:113341822-113341844 TTTTATTTTTAGAGATGGGAGGG + Intronic
1113858412 13:113463517-113463539 TTTTTTTTTTAAAGAGGTGAGGG - Intronic
1114351036 14:21851582-21851604 TTTTTTGTGTAGAAAGAGTATGG - Intergenic
1114390593 14:22303877-22303899 TTTTTTTTTTATGAAAGGGAGGG + Intergenic
1114440476 14:22742657-22742679 TTTTTTCTTTTAAATGGAGACGG - Intergenic
1114444406 14:22777130-22777152 TTTTTTTTTTAGACAGGGTCTGG - Intronic
1114723994 14:24914527-24914549 TATTTTATTTAGGAAGGGGGAGG - Intronic
1114949611 14:27732393-27732415 TTTATTTTTTAGGAAGGAGAAGG - Intergenic
1114976245 14:28104266-28104288 TGTGTACTTTAGAAAGGTGATGG - Intergenic
1115063826 14:29229032-29229054 TTTTTTGGTTAAGAAGGGGAGGG - Intergenic
1115182813 14:30649109-30649131 TGTTTTCTTTATTAATGGGAAGG + Intronic
1115200363 14:30847286-30847308 TTTCTTCAATGGAAAGGGGATGG - Intergenic
1115215896 14:31013764-31013786 TCTTTTCTGTAGAAACGGGGGGG + Intronic
1115667349 14:35566120-35566142 TTTTTTTTTCAGGCAGGGGAGGG - Intronic
1117278130 14:54209931-54209953 TTTTTTTTTTAGCACTGGGAAGG - Intergenic
1117392252 14:55272622-55272644 TTTTTTCTGTTGTAAAGGGAGGG + Intronic
1117398935 14:55340406-55340428 TTTTTTTTTTTGAATGGGGGTGG + Intronic
1118197943 14:63645511-63645533 TTTTTTCTTTAATAGGGGCAGGG + Intergenic
1119220494 14:72902643-72902665 TTTTTTTTTTTTAATGGGGAGGG - Intergenic
1119282419 14:73420860-73420882 TTTTTTCTTGAGACAGGGTCTGG - Intronic
1119416052 14:74470167-74470189 TTTTTTTTTTTAAAAAGGGAAGG - Intergenic
1119688567 14:76652853-76652875 TTTTTGTTTGAGAAAGGGTATGG + Intergenic
1119739588 14:77005510-77005532 TTTTTCCTTTAGGAAGGCAATGG + Intergenic
1120006489 14:79363585-79363607 TTTTTTCTTAAGAAAGTAGAAGG - Intronic
1120080654 14:80212338-80212360 TTTTTTTTTTAGAAGGGGTTGGG + Intronic
1120102116 14:80457073-80457095 GTTTTTATTTGGGAAGGGGAAGG - Intergenic
1120234966 14:81880256-81880278 TTTTTTCTTGAGAAATTTGAAGG + Intergenic
1120263829 14:82224103-82224125 TGTTTTCAGTAGAGAGGGGAGGG - Intergenic
1120352395 14:83379462-83379484 GTGTTTTTTTAGAGAGGGGAGGG + Intergenic
1120713211 14:87814616-87814638 AATTTGGTTTAGAAAGGGGAGGG - Intergenic
1121015355 14:90545688-90545710 ATTTTTGTTTAGAAAGTGGCAGG + Intronic
1121231340 14:92361010-92361032 TTTAATCTTTAAAAAGGAGAGGG + Intronic
1121402567 14:93693066-93693088 GTTCTTAATTAGAAAGGGGATGG + Intronic
1121457958 14:94050873-94050895 TTTTTTTTTTAGATAGAAGATGG - Exonic
1121533020 14:94671815-94671837 TTTGTTTTGAAGAAAGGGGAGGG + Intergenic
1122260438 14:100516933-100516955 TTTTTTTTTTTTAAAGGAGATGG + Intronic
1122313608 14:100812756-100812778 TTGTTCCTTTAAGAAGGGGAAGG + Intergenic
1122313655 14:100813088-100813110 TTGTTCCTTTAAGAAGGGGAAGG - Intergenic
1122351377 14:101095285-101095307 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1122455229 14:101845126-101845148 TTTTTTTTTTAAACAGGGAAAGG - Intronic
1122483831 14:102065121-102065143 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1122762204 14:104037576-104037598 TTTTCAATTTAAAAAGGGGAAGG + Intronic
1124094228 15:26633825-26633847 ACTTTGGTTTAGAAAGGGGAAGG - Intronic
1124165484 15:27322096-27322118 TTTTTTCTTTGCAAAAAGGAAGG + Intronic
1124189256 15:27558348-27558370 TTTTTTCTTTAGTAATGTAATGG + Intergenic
1124671008 15:31639102-31639124 TTTTTTTTTTAGACAGAGGCTGG - Intronic
1125910687 15:43436001-43436023 TTTTTTCTTTAGACAGAGTCTGG + Intronic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1126220092 15:46203625-46203647 TGGTTTCCTTAGATAGGGGAGGG + Intergenic
1126304236 15:47236779-47236801 CATTTCCTTTAGGAAGGGGAAGG + Intronic
1126497043 15:49303248-49303270 TTTTTAGTTTTGAAGGGGGAAGG - Intronic
1126589913 15:50328226-50328248 TTTTTTTTTTAGAAAGGAATAGG - Intronic
1126945114 15:53810648-53810670 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1127028979 15:54840585-54840607 TTTTTTTTTTAGAAAGAGACAGG - Intergenic
1127178647 15:56390085-56390107 TTTTTTTTTAATAAAAGGGATGG + Intronic
1127255505 15:57288895-57288917 TTTTTTTGTGAGAAAGGGTATGG - Intronic
1127266546 15:57366917-57366939 TTTGTTTTTTAGAGATGGGAGGG + Intergenic
1127546491 15:59998155-59998177 TTTTTTTTTTAAAGTGGGGAGGG - Intergenic
1127887050 15:63210712-63210734 TTTTCTATTGAGAAAGGGGTGGG + Intronic
1127894270 15:63281122-63281144 TTTTTTTTTTAGACAGGGTCTGG - Intronic
1127923362 15:63512741-63512763 TTGTATCTTAAGAAAGGGGGAGG - Intronic
1128195893 15:65755757-65755779 TTTTTTCTTTTTAAAGGGACAGG - Intronic
1128508224 15:68294593-68294615 TTTTTTTTTTGGAATGGGGTGGG + Exonic
1128940023 15:71780477-71780499 TTCTCTCTGTAGAAAAGGGATGG + Exonic
1128964996 15:72050162-72050184 TTTTTTTTTTACAAAAAGGAGGG + Intronic
1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG + Intronic
1129280057 15:74477799-74477821 TTTTTTTTTTAAAAAAGGAAAGG - Intergenic
1129492464 15:75941979-75942001 TTTTTTTTTTAAAAAGGGCAGGG + Exonic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130174098 15:81549483-81549505 TTTTTTCTTGAGAAAGAGTCTGG + Intergenic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1130246455 15:82254447-82254469 TTTTTCCTTTTGAAATGGGATGG - Intronic
1130454168 15:84088510-84088532 TTTTTCCTTTTGAAATGGGATGG + Intergenic
1130511256 15:84591291-84591313 TTTTTTCCTTACAAAGCTGATGG + Intergenic
1130851271 15:87796091-87796113 TTTTTTCTTTAAAGAGTGCATGG - Intergenic
1131517767 15:93090221-93090243 TTTGTTCTGTAAGAAGGGGAAGG - Intergenic
1131953039 15:97702356-97702378 TTGTTTCTTTTGAAACGGTAAGG - Intergenic
1132008221 15:98250043-98250065 TCTTTTATTTGGAAAGTGGAAGG - Intergenic
1133182729 16:4070642-4070664 TTTTTTCTTTTTAAAGAGAAAGG - Intronic
1133451690 16:5909391-5909413 TATTTTTTTTAGAAAGGGCTTGG - Intergenic
1133663642 16:7943756-7943778 ATTTTTCTTTAGAGAGCAGAAGG - Intergenic
1133803668 16:9106235-9106257 TTTTTTCTTTAAATAGGGAGAGG - Intronic
1133971711 16:10572913-10572935 ATTTGTCTTTGGAATGGGGATGG - Intronic
1134128216 16:11630761-11630783 TTTTTTCTAGAGACAGGGGTCGG + Intronic
1134904957 16:17972263-17972285 TGTTTTCAGGAGAAAGGGGAAGG - Intergenic
1135130425 16:19849459-19849481 TTTTTTCTTTAGAAAGGCAGGGG + Intronic
1135246215 16:20859529-20859551 TTTTTTTTTTTGGTAGGGGAGGG - Exonic
1135284788 16:21184136-21184158 TATTTTCTTTAGAAACTGAATGG + Intergenic
1135598205 16:23759622-23759644 TTTTTTTTTTAAAAAGAGGTGGG + Intergenic
1135601801 16:23789938-23789960 TTTTTTCTTGAGACAGGGTCTGG - Intergenic
1135735566 16:24929162-24929184 TTTTTTTTTTAAAAAGAGGCAGG + Intronic
1135871730 16:26157383-26157405 TTTTTTCTTCAGAAAGAGCATGG + Intergenic
1136099673 16:27984619-27984641 TTTTTTTTCTAGATAGGGGAAGG + Intronic
1136242394 16:28952071-28952093 TTTTTTCTTTCGGTAGGGGAAGG + Intronic
1137006278 16:35276663-35276685 TCCTTTGTTTAGAAAGGGGAGGG + Intergenic
1137038422 16:35587555-35587577 TTTTTTTTTGAGAGAGGGTAGGG + Intergenic
1137403831 16:48174995-48175017 TTTATTTTTTAGAAACTGGATGG - Intronic
1137985418 16:53103201-53103223 CTTTTTCTTTAAAAAAGAGATGG + Intronic
1138050120 16:53767585-53767607 TTTTTTTTTTAAACAGGGGAAGG + Intronic
1138185730 16:54976012-54976034 TTTTTTCTTTAGTAAAGACAAGG + Intergenic
1138254554 16:55543766-55543788 TTTTTTCATTTGACAGGAGAGGG + Intronic
1138450380 16:57090537-57090559 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1139171661 16:64637761-64637783 TTTTTTTTTTATAAAGGGAGTGG - Intergenic
1139410788 16:66758727-66758749 TTTTTTCTTGAGACAGGGTCTGG - Intronic
1139834033 16:69824048-69824070 TTTTGTTTTTGGCAAGGGGAAGG - Intronic
1140195955 16:72855638-72855660 TGTTTGCTTTTTAAAGGGGAAGG - Intronic
1140201697 16:72900124-72900146 TTTTTTTTTTGGCAAGGGCATGG - Intronic
1140205488 16:72929227-72929249 TTTTTTTTTTAGACAGGGTCTGG - Intronic
1140240563 16:73196156-73196178 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1140278636 16:73533738-73533760 TTTTTTCTTGAGCAAATGGAGGG - Intergenic
1140298338 16:73730341-73730363 TTTTTTTTTTTGCGAGGGGAGGG - Intergenic
1140322986 16:73971915-73971937 TTTTTTTTCTGGACAGGGGAGGG + Intergenic
1141595878 16:85096698-85096720 TTTTTTCATTAGCAAAGTGAGGG - Intergenic
1141928088 16:87182354-87182376 TTTCTTCTTTAACATGGGGATGG - Intronic
1143412217 17:6716489-6716511 TTTTTTTTTTTGCAGGGGGACGG - Intergenic
1143494579 17:7304961-7304983 TTTTTTTTTTACAAAGGAAAGGG + Intergenic
1143659242 17:8314731-8314753 TTTTTTTTTTTGAAGGGGAAAGG - Intronic
1143668000 17:8375540-8375562 TTTTTTTTTTTGAGAGGGTAGGG + Intronic
1143729826 17:8874995-8875017 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1143808310 17:9448886-9448908 TTTTTGCTTTTGAAAGGTAAGGG + Intronic
1144095899 17:11900492-11900514 TTTTTTTTTTTGGCAGGGGAAGG - Intronic
1144229259 17:13183234-13183256 TTTTTTCGGTCGAAAGGTGAAGG + Intergenic
1144229544 17:13187328-13187350 TTTTTTTTTTCCAAAGAGGATGG + Intergenic
1144552725 17:16255642-16255664 TTTGTTTTTTTGTAAGGGGAAGG - Intronic
1145038517 17:19558806-19558828 TTTATTCATTACAAAGGGAAAGG - Intronic
1145945495 17:28771015-28771037 TTTTTTTTTTTTAAAGGAGAGGG + Intronic
1146071318 17:29684473-29684495 TTTTTTTTTTTTAATGGGGACGG - Intronic
1146233789 17:31138273-31138295 TTTTTTCTTGAGACAGGGTCTGG + Intronic
1146264651 17:31444353-31444375 TTTTCTCTTTAGAAGGGTGGGGG - Intronic
1146514962 17:33481984-33482006 TGTTTTCTAAAGAAAGGAGAGGG - Intronic
1146958445 17:36951169-36951191 GTTTTCCTTTAGAAAGGTCAGGG + Intronic
1147127414 17:38381296-38381318 TCTTTTGCTTATAAAGGGGAAGG + Intronic
1148500131 17:48083818-48083840 TTTTTTTTTTGGAGGGGGGATGG - Intronic
1148548106 17:48532095-48532117 TTTTTTTTTTTGGAAGGAGATGG - Intergenic
1148575641 17:48709052-48709074 TTTTTTTTTAAGAAATGGGGAGG - Intergenic
1149056153 17:52368719-52368741 TTTTTTTTTTACAAATTGGAAGG + Intergenic
1149441551 17:56678569-56678591 TTATTTTTTTAGAAAGGAGAAGG - Intergenic
1149454644 17:56777898-56777920 AGTTTTCTTCAGAAAGTGGATGG - Intergenic
1149732281 17:58958214-58958236 TTTTTTTTTTAGAGAGAGAAAGG + Intronic
1149892334 17:60401148-60401170 TTTTTTTTTTAGACAGGGTCTGG - Intronic
1149918574 17:60634948-60634970 TTTTTTCTTTTTTAAGGAGACGG + Intronic
1150451730 17:65274562-65274584 TTTTGTCTTTGAAAAGGGAAGGG - Intergenic
1150525301 17:65916542-65916564 TTTTTTTTTTTGAAATGGGTGGG + Intronic
1150573468 17:66409020-66409042 TTTTTTTTTGAGACTGGGGAGGG - Intronic
1150577848 17:66445814-66445836 TTTTTTCTTGAGACAGGGTCTGG + Intronic
1150837161 17:68574633-68574655 TTTATCCTTTACAAAGGGGAAGG + Intronic
1150942709 17:69710571-69710593 TTTTATCTTTACAAATGGCAAGG + Intergenic
1151722540 17:75865649-75865671 TTTTTTTTTTTGGCAGGGGAGGG + Intergenic
1151977595 17:77491226-77491248 TTTTTTTTTGAGAAAGGGTCTGG + Intronic
1152427285 17:80225182-80225204 TTTTTTCTTTAGAGAGCGGCGGG - Intronic
1152970903 18:159674-159696 TTATGGCTTTAGAAAGGGGTTGG - Intronic
1153276415 18:3372173-3372195 TTTTTTTTTTAGAGATGGAAGGG + Intergenic
1153329326 18:3856854-3856876 TTTTTTTTTTTGGAGGGGGACGG - Intronic
1153482590 18:5562526-5562548 TTTGATATTTATAAAGGGGATGG + Intronic
1154040028 18:10845864-10845886 TTTTTGCTTTAGAAAAATGATGG - Intronic
1154425884 18:14271784-14271806 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1154430899 18:14307722-14307744 ATTTTGGTTTAGAAAGGGGGAGG + Intergenic
1154433572 18:14327026-14327048 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1154970713 18:21406046-21406068 TTTTTTTTTTAGACAGGGTCTGG - Intronic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155533855 18:26795255-26795277 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1155553530 18:26992770-26992792 TTTTTTCTTGAGCAATGCGATGG + Intronic
1155782015 18:29849254-29849276 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1156025954 18:32655412-32655434 CTTTGCCTTTTGAAAGGGGAAGG - Intergenic
1156093994 18:33507842-33507864 CTCATTCTTTAGGAAGGGGAAGG - Intergenic
1156249748 18:35341487-35341509 TTTTTTATTTAGTAAGTAGAAGG - Intronic
1156652804 18:39245634-39245656 TTTTTTTTTTAGAACAGGAATGG - Intergenic
1156682936 18:39613190-39613212 TTTTTTCTTTAAAAAGGCTGAGG + Intergenic
1157434754 18:47658921-47658943 TTTTTTTTTTAGAAAGAGAGAGG - Intergenic
1157553714 18:48598878-48598900 TTTTTCCTGGAGAAAGGGCAGGG + Intronic
1157719203 18:49910556-49910578 TTTTTTTTTTAAACAGGGTAAGG - Intronic
1158633157 18:59133563-59133585 TTTTTCGTCTAGAAAGAGGAAGG + Intergenic
1159056136 18:63465761-63465783 TTTTTTTTTTAGACAATGGAAGG + Intergenic
1159267587 18:66102711-66102733 TTTGTTCTTTAAAAATGGGAAGG + Intergenic
1159524899 18:69575790-69575812 TTTTATATTTACAAAGGAGAAGG + Intronic
1159570793 18:70110224-70110246 TTTTTTTTTTAAAAAGGGATGGG - Intronic
1159570794 18:70110225-70110247 TTTTTTTTTTTAAAAAGGGATGG - Intronic
1160377950 18:78428451-78428473 TTTTTTTTTTAGATAGGGTCTGG + Intergenic
1160784840 19:895245-895267 TTTTTTTTTTAGACAGGGTCTGG - Intergenic
1160895028 19:1398445-1398467 TTTTTTCTTGAGACAGGGTCTGG + Exonic
1161264093 19:3355555-3355577 TTTTTTTTTAAGAAATGGGGGGG + Intergenic
1161456426 19:4371982-4372004 TTTTTTCTTTTTAAAGAGGCAGG + Intronic
1162078223 19:8203158-8203180 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1162376291 19:10307352-10307374 TTTTTTTTTTTTTAAGGGGATGG + Intronic
1162413769 19:10521607-10521629 TTTTTTCTTGAGATAGGGTCTGG + Intergenic
1163380073 19:16960198-16960220 TTTTTTTTTGAGAAAGGAGAAGG - Intronic
1163535991 19:17876854-17876876 TTTTTTTTTTAGGGGGGGGACGG - Intronic
1164092059 19:21964535-21964557 TTTTTTCATTAGAGAGAAGAAGG - Intronic
1164219422 19:23179880-23179902 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1164220202 19:23186411-23186433 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1164579896 19:29428611-29428633 TTTGTTCTTTTGAGAGGGGTGGG - Intergenic
1164697286 19:30255170-30255192 TTTTTTCATTCAAAAGAGGATGG + Intronic
1164797944 19:31050800-31050822 ATTTTTCTTTAGTATGGGGGAGG + Intergenic
1164969420 19:32518550-32518572 TTTTTTCTTTTGAGGAGGGAGGG - Intergenic
1165046123 19:33106442-33106464 TTCTTTCTGTAGAAATGGGTGGG + Intronic
1165147837 19:33743162-33743184 ATATTGCTTTAGAAAGGGGTGGG + Intronic
1165253892 19:34560967-34560989 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1165273175 19:34727629-34727651 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1165523223 19:36330621-36330643 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1165530701 19:36398009-36398031 TTTATTCTTGGGAAAAGGGATGG - Intronic
1165658565 19:37554876-37554898 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166290875 19:41862643-41862665 TTTTTTTTTTAACATGGGGAGGG + Intronic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
1166800680 19:45455235-45455257 TTTTTTTTTTAGATAGGGTCTGG + Intronic
1167208338 19:48117454-48117476 TTTTTTCTTTAAAAATGGGCCGG - Intronic
1167326622 19:48830471-48830493 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1168122442 19:54259408-54259430 CTTTGCCTTAAGAAAGGGGAGGG - Intronic
1168615078 19:57830896-57830918 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1168688062 19:58360378-58360400 TTTTTTCTTTTGACAGGGTCTGG + Intronic
925621569 2:5798678-5798700 TTTTTTCTTCAGAAATTTGAAGG + Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
925717226 2:6795621-6795643 TAATTTTTTTAAAAAGGGGATGG - Intergenic
925853524 2:8107409-8107431 TTTTTTTCTGAGAAAGGGGTGGG - Intergenic
926467537 2:13209493-13209515 TGTTTTCTTTAAAAAGGAGATGG + Intergenic
926478401 2:13357164-13357186 CTCTGTCTTTAGAAAGGGGAGGG + Intergenic
926664292 2:15503233-15503255 TTTTTTTTTTAGTAAGTAGAAGG + Intronic
926712973 2:15897764-15897786 TTTTTTTTTTCAGAAGGGGAAGG + Intergenic
926761563 2:16282983-16283005 TTTCTTCTTTCGCAAGGAGAGGG + Intergenic
926798281 2:16636783-16636805 TTTTTTTTTTGGCAAGGGGTTGG - Intronic
926808068 2:16730621-16730643 TTTTTTCCCTAGGGAGGGGAAGG - Intergenic
927711808 2:25330792-25330814 TTTTCTTTTTAATAAGGGGAGGG - Intronic
927742123 2:25580545-25580567 ATTTTTTTTTAAAAAAGGGAGGG - Intronic
928101869 2:28443214-28443236 TTTTTTTTTTAGACAGGGTCTGG + Intergenic
928261896 2:29775526-29775548 TTTTTTTTTTTGTAGGGGGAGGG - Intronic
928296969 2:30092068-30092090 TAATTTCTTTAGAATTGGGAGGG - Intergenic
928867722 2:35937260-35937282 TTTTTTCTTGGGAAAGGAGATGG + Intergenic
929306161 2:40364873-40364895 TTTTTTCTTGAGAAATGACAGGG + Intronic
929343147 2:40847520-40847542 TTTTTTTTTGAGAAAGGGTCTGG - Intergenic
929373904 2:41260790-41260812 TTTTTTTTTTTGGTAGGGGAGGG + Intergenic
929703645 2:44188151-44188173 TTTGTTTTTAAGAAGGGGGATGG + Intronic
929748226 2:44681545-44681567 TTTTTTTTTTTGGAGGGGGAGGG + Intronic
930321636 2:49862099-49862121 TTTTTTCCTTAATAAGGTGAAGG - Intergenic
930608602 2:53517390-53517412 TTTTTTTTCTTGAAAAGGGAGGG - Intergenic
930660089 2:54044596-54044618 TTTTTTTTTTTGAGAGGGGCGGG - Intronic
930841456 2:55851600-55851622 TTTTTTTTTGAGACAGGGTATGG - Intergenic
931008082 2:57875622-57875644 TTTTTCCTTAAAAAAAGGGATGG - Intergenic
931241091 2:60453269-60453291 TTTCTTTTTTGGAAGGGGGAAGG + Intronic
931375838 2:61707406-61707428 TTTTTTTTTGAGAAAGGGTCTGG + Intergenic
931738984 2:65225051-65225073 TTTTTTTTTTAGATAGGGTCTGG + Intergenic
931878407 2:66539962-66539984 TTTTTTGTTAAAAAAGGGAATGG + Intronic
931962078 2:67493293-67493315 TTTTTTCTTTAGAAAGAAAAAGG + Intergenic
932057870 2:68465510-68465532 TTTTTTTTTTAAAGAGGGGCGGG - Intronic
932175173 2:69594133-69594155 ATTTTTCTTTGGGAAGGGGAGGG + Intronic
932636884 2:73397387-73397409 TTTTTTTTTTATGATGGGGATGG + Intronic
932810551 2:74822238-74822260 TTTTTTTTTTAGAGAGAAGAAGG - Intergenic
933371702 2:81422966-81422988 TTTTTTTTTTGGCAGGGGGAAGG + Intergenic
933886650 2:86724094-86724116 TTTTTTCTTTTAAATGGGGTTGG + Intronic
933923530 2:87072613-87072635 TTTTTTCTTTTAAATGGGGTTGG - Intergenic
934115448 2:88786957-88786979 ATGTTTCTATGGAAAGGGGAAGG + Intergenic
934628136 2:95881978-95882000 ATGTTTCTATGGAAAGGGGAAGG - Intronic
934805270 2:97217674-97217696 ATGTTTCTATGGAAAGGGGAAGG + Intronic
934832089 2:97537844-97537866 ATGTTTCTATGGAAAGGGGAAGG - Intronic
935132851 2:100274364-100274386 TTTTTCCTCTAGAGAGGGGCGGG - Exonic
935196141 2:100818236-100818258 TTTCTTCTTTTGGAAAGGGAGGG + Intergenic
936031051 2:109070846-109070868 TTTTTTTTTTAGATAGGGTCTGG - Intergenic
936098307 2:109551583-109551605 TGTTTTCTTAGGTAAGGGGAAGG + Intronic
937047636 2:118860191-118860213 TTTTTTTTTTGGAGGGGGGAAGG + Intergenic
937325544 2:120987917-120987939 TTTTTCAATTAAAAAGGGGAAGG - Intronic
937533400 2:122857169-122857191 GTTTTTCTTTTGACAGGGTAAGG - Intergenic
937597840 2:123691366-123691388 ACTTTGGTTTAGAAAGGGGACGG - Intergenic
937837478 2:126486915-126486937 TTTTTTTTTTACAAAAAGGAGGG - Intergenic
938584810 2:132679745-132679767 TTTGTTCATCAGAAAAGGGATGG - Intronic
938650363 2:133376673-133376695 TTTATTTTGTAGACAGGGGAAGG - Intronic
938837583 2:135122595-135122617 ATTTTCCTTTATAAGGGGGAAGG + Intronic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
938947490 2:136226287-136226309 TTGTTTCACTAAAAAGGGGAAGG - Intergenic
938996031 2:136679113-136679135 TTTTCTCTTAAGAAAGGGAATGG + Intergenic
939131350 2:138239163-138239185 TTTTTTTTTTGTAAAGGAGATGG + Intergenic
939164253 2:138623006-138623028 GTTTTTCTTTTAACAGGGGAAGG + Intergenic
939362202 2:141186882-141186904 TTTGTTTTTAAGAATGGGGAAGG + Intronic
939393060 2:141593421-141593443 TTTTTTCTTAAGAAGGGGCCGGG + Intronic
939428293 2:142069713-142069735 TTTTTTCTTTAACAAGGAGTAGG + Intronic
939529097 2:143335274-143335296 TTTTTAATTTAGAAAGTTGAAGG - Intronic
939677154 2:145086624-145086646 TTCTTTCTAAAGAAAGGTGATGG - Intergenic
939886640 2:147688407-147688429 TTTATTCTTTAGAACTGGGAAGG + Intergenic
940323531 2:152401500-152401522 TTTTTGATCTTGAAAGGGGAAGG + Intronic
940503727 2:154527117-154527139 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
940560396 2:155288065-155288087 CTCTGTCTTTGGAAAGGGGAAGG + Intergenic
940709881 2:157149048-157149070 TTTTTTTTTTGGAAAGGGGAAGG - Intergenic
940844595 2:158625845-158625867 TTTTTTCTTTAGAAATGCTTTGG + Intronic
941016748 2:160366134-160366156 GTGTTTGTTTTGAAAGGGGAGGG - Intronic
941190501 2:162375883-162375905 TTTTTTTTTTAGATAGGGTCTGG - Intronic
941457273 2:165724454-165724476 TTTTTTCTTTAAAAAAGGAGGGG + Intergenic
941791422 2:169556422-169556444 TTTTTTTTTGAGACAGGGTATGG - Intronic
942246931 2:174016515-174016537 GTTTTTCTGTGGAAAGGTGAGGG - Intergenic
942454951 2:176130956-176130978 TTTTTTTTTAAGAAGGGAGAGGG + Intronic
942540781 2:177013377-177013399 TTTTTTCTTTTTTAAGAGGAAGG + Intergenic
942602156 2:177652503-177652525 TTTTTCCTGTAGTAAGGGGGAGG + Intronic
942968243 2:181923683-181923705 TTTTTTTTCTAGAAATGTGATGG + Intronic
943467278 2:188243635-188243657 TTTTTTCTACAGTAAGAGGAAGG - Intergenic
943672099 2:190673938-190673960 TTTTTGTTTTAGGCAGGGGATGG + Intronic
944171696 2:196786505-196786527 TTTATCCTTGATAAAGGGGAAGG - Intronic
944580279 2:201126174-201126196 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
944737221 2:202577993-202578015 TTTTTTCTTGAGAACGGGCCAGG + Intergenic
944749346 2:202692298-202692320 TTTTATCTTTTGGCAGGGGAAGG - Intronic
944929952 2:204507216-204507238 TTTTTTTTTGAGAAAGGGCCTGG - Intergenic
945092793 2:206191677-206191699 TTTTTTTTTTAGACAGGGTCTGG + Intronic
945546467 2:211158960-211158982 CTTTTTCTTTAGCACGGGGTGGG + Intergenic
945580770 2:211592036-211592058 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
945629540 2:212256002-212256024 TTTTTTTTTTACAAATGGGGGGG + Intronic
945872937 2:215246586-215246608 TTTTTTTTTTTGAAAGGGTTGGG - Intergenic
946833840 2:223751842-223751864 TTTTTTTTCTTGAAATGGGATGG - Intronic
946917835 2:224543977-224543999 TTTTTTTTTTTGAAATGGGAGGG - Intronic
947118082 2:226792147-226792169 TTTTTTCTTTTAAAGGGGGAGGG + Intronic
947247807 2:228069455-228069477 TTTTTTTTTTAGAGATGGGGGGG + Intronic
947422523 2:229953696-229953718 TTTTTTTTTTCAAGAGGGGAAGG + Intronic
947487374 2:230564386-230564408 TTTTGTCTTTGGAAAGGAGGAGG + Intergenic
948288537 2:236806828-236806850 CTTTTTATTTAAAAAAGGGAGGG + Intergenic
948612633 2:239179551-239179573 TTTTTTCTGTGGACAGGGGTGGG - Intronic
1168756143 20:319235-319257 TTTTTTTTTTTGAGACGGGACGG - Intergenic
1168780556 20:485732-485754 TCTTTTCTTAAAAAAGAGGAGGG + Intronic
1169165315 20:3417988-3418010 TTTTTTTTTTAGACAGGGTCTGG - Intergenic
1169711411 20:8568667-8568689 TTTTTTCTTTACACAGAGTAGGG + Intronic
1169777697 20:9274178-9274200 ATTTTTCTTTAGAAAGGAAAAGG + Intronic
1169995470 20:11551335-11551357 ATTTGTATTTAGAAAGGGGAAGG - Intergenic
1170545186 20:17430201-17430223 TTTTTTTTTCTGAGAGGGGAGGG - Intronic
1170654298 20:18271692-18271714 TTTTTTTTTAAGAAACAGGAAGG - Intergenic
1170715275 20:18825549-18825571 TTTTGGCTTTAGAAAGGTGGTGG + Intronic
1170786291 20:19470373-19470395 TTTTTTCTCTGAAAAGGGGGAGG + Intronic
1170941841 20:20854495-20854517 TTTTTTCTTTTGTAATGGGACGG + Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172176478 20:32975511-32975533 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1172706576 20:36886611-36886633 TTTTTTTTAGAGATAGGGGAGGG + Intronic
1173004099 20:39126640-39126662 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1173354218 20:42271732-42271754 GTTTTTCTTTAGAGAGGTGAGGG - Intronic
1173632085 20:44524171-44524193 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1173967691 20:47125888-47125910 TTTTTTCTTTAAAAGAGAGAGGG + Intronic
1174628616 20:51936935-51936957 TTTTTTCTTGAGACAAGGTATGG + Intergenic
1174647423 20:52097895-52097917 TTTTTTTTTTAAATAGGGGGCGG - Intronic
1175027753 20:55920892-55920914 TTTTTTTTTAAAAAAGGGGTAGG - Intergenic
1175455657 20:59111453-59111475 TTGTTGTTTTAGAAAGGGAAAGG - Intergenic
1175582183 20:60108772-60108794 TTTTTTTTTTAGTAAGTAGAAGG - Intergenic
1175938167 20:62524690-62524712 TTTTTTCTTTAAGAAGCAGAAGG + Intergenic
1176182824 20:63759395-63759417 TTTTTTCTTTAGTAAAGACAGGG + Intronic
1176417515 21:6486061-6486083 TTTTTTTTTTGGAAGGGGGAGGG + Intergenic
1176807338 21:13499465-13499487 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1176843464 21:13858719-13858741 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1176846143 21:13878045-13878067 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1176871370 21:14085235-14085257 TCTTTTCTTTGCAAAGGGCAAGG - Intergenic
1177123922 21:17172121-17172143 TTTTCTATTTGTAAAGGGGAAGG + Intergenic
1177350274 21:19930371-19930393 TTTTTTTTTTAGAAAAAAGAAGG + Intergenic
1177444497 21:21175050-21175072 TTTTTTCTTTAAAAAGAAAAAGG + Intronic
1177514839 21:22135759-22135781 TTGTTTCTTGATAAAGGAGAAGG - Intergenic
1177718837 21:24877995-24878017 TTTTTTGATTAGTATGGGGAAGG - Intergenic
1177765075 21:25448938-25448960 ATTTTTTTTTAGAGATGGGAGGG - Intergenic
1177921644 21:27159905-27159927 TTTTTTTTTTGGAAAAAGGAAGG - Intergenic
1178237745 21:30862528-30862550 TTTTCTCTCTGGAAAGGTGAAGG - Intergenic
1178938904 21:36888422-36888444 TTTTTTTTTTTTAAATGGGAAGG - Intronic
1178940188 21:36899047-36899069 TTTTTTCTTGAGACAGGGTTTGG - Intronic
1178980012 21:37255863-37255885 TTTTTTTTTTAGATAGAGGCTGG + Intronic
1178995593 21:37396215-37396237 TTTTTTTTTTAGGTTGGGGATGG + Intronic
1179039177 21:37786475-37786497 TATTTTCTTCTGAAAGGAGATGG - Intronic
1179295031 21:40054158-40054180 TCTTTTTTTGGGAAAGGGGAAGG - Intronic
1179347835 21:40577681-40577703 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1179669536 21:42936842-42936864 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1179693011 21:43094394-43094416 TTTTTTTTTTGGAAGGGGGAGGG + Intronic
1180648453 22:17359221-17359243 TTTTTTTTTTAGATAGGGTCTGG + Intergenic
1180733264 22:17997917-17997939 TTTTTTTTTTTGGAAGCGGAAGG - Intronic
1181790087 22:25258436-25258458 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1182314141 22:29432459-29432481 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1182820065 22:33207975-33207997 TCTTTTCTTTAGACTGGAGAGGG + Intronic
1183233695 22:36599717-36599739 TGTTTTCTTGAGATAGGGTAGGG + Intronic
1183821017 22:40346143-40346165 TTTGTTTTTTAGAGACGGGAGGG + Intergenic
1183847935 22:40558264-40558286 TTTTTTTTTTTGCAAGGGGTTGG + Intronic
1184056094 22:42050649-42050671 TTTTTTTTTTTGGGAGGGGACGG - Intronic
1184472945 22:44706100-44706122 TTTTTACAAGAGAAAGGGGAGGG - Intronic
1184512939 22:44943633-44943655 TGTTTGCTTTACAAAGGGGGTGG - Intronic
1184672240 22:46020471-46020493 TTTTTTTTTTAAATAAGGGATGG - Intergenic
1184970353 22:48015543-48015565 TTTTTTCTTCTCATAGGGGAAGG + Intergenic
949254680 3:2031428-2031450 TGTTTTACTTAGAAATGGGACGG - Intergenic
949644705 3:6079250-6079272 TTTTATCTTATGAAATGGGAAGG - Intergenic
949806524 3:7961506-7961528 TGCTTTCCTTAAAAAGGGGATGG + Intergenic
950089603 3:10286220-10286242 TTTTTTCTTTTACAAGGTGAGGG + Intronic
950845770 3:16014812-16014834 TTTAGTCTTTGGAAAAGGGATGG - Intergenic
951004761 3:17603088-17603110 TATTTTCTTTGGAGAGAGGATGG - Intronic
951373663 3:21886512-21886534 TTATTTCTTCAGAAAGGATAAGG - Intronic
951435406 3:22657121-22657143 CTCTTCCTTTGGAAAGGGGAGGG - Intergenic
951473323 3:23079176-23079198 TTTTTTTTTTAGACAGGGTCTGG - Intergenic
951712220 3:25594826-25594848 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
951761857 3:26156987-26157009 TTTTTTTTTGAGAAGGGGTAGGG + Intergenic
951834058 3:26961625-26961647 TTTTTTTTTTAGAAAAAGGTTGG + Intergenic
952060232 3:29499318-29499340 TCTTTTCTTTACTAAAGGGAAGG - Intronic
952127380 3:30316729-30316751 TTGCTTATTTAGAAAGGGAAGGG + Intergenic
952203080 3:31151373-31151395 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
952249542 3:31638014-31638036 TTGTTTCCTGAGAAAGGTGAGGG - Intergenic
952252555 3:31668910-31668932 TTTTTTAATCAGAAATGGGAAGG + Intronic
952346581 3:32493415-32493437 TTTTTTCTTTTTAAAAGGCAAGG + Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953760916 3:45686220-45686242 ACTTTGGTTTAGAAAGGGGAGGG - Exonic
954255873 3:49405529-49405551 TTTCTTCTGTAGAAAGGGAATGG - Intronic
954341425 3:49956987-49957009 TTTTTTCTTTTTAAGAGGGAGGG + Intronic
954805219 3:53215077-53215099 TTATTTCTTTAAAAAAGTGATGG - Intergenic
954896665 3:53980831-53980853 TTGTTTCTTTGGAAAAGGTAAGG - Intergenic
955061919 3:55499968-55499990 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
955077546 3:55627898-55627920 TTTTTTTTGAAGAAAGGGGGCGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955264052 3:57424295-57424317 TTTTATCTTTAGTAAAGGCAGGG - Intronic
955373858 3:58377593-58377615 TTTTTTTTTTAGAAAGAGATAGG - Intronic
955867926 3:63405139-63405161 TTCTCACTTGAGAAAGGGGAAGG - Intronic
956016551 3:64889866-64889888 TTTTTTTTTTAAAAAAAGGAAGG - Intergenic
956246070 3:67185119-67185141 TTTTTTTGTTAGAAAAGGAAAGG + Intergenic
956544068 3:70379757-70379779 TTTTTTCTCTATAAAGGACAAGG - Intergenic
956585195 3:70856658-70856680 TTTTTTTTTTTGCAGGGGGACGG + Intergenic
956879077 3:73492011-73492033 TTTTTCCTTTAGAGAGGGTGGGG - Intronic
957063387 3:75500374-75500396 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
957508770 3:81160130-81160152 TTTTTGCGTTAGAAAGAGTAAGG + Intergenic
957697610 3:83661610-83661632 TTTTTCTTTTAGAAATAGGATGG - Intergenic
957748970 3:84387124-84387146 TTTATTCCTTAGAAAGAGAATGG + Intergenic
957971540 3:87388815-87388837 TTTTTTTTTGATAAAGGGAAAGG + Intergenic
958107371 3:89093303-89093325 TTTTTTATATAGAAAGGAAATGG - Intergenic
958141188 3:89564494-89564516 TTTTGCCTTTGGAAAAGGGAGGG + Intergenic
958634207 3:96722158-96722180 TTTTTTTTTTTGCAAGGGGTAGG - Intergenic
958876741 3:99625111-99625133 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
958899860 3:99872921-99872943 TTTTTTTTTTAAAAAAAGGAGGG + Intronic
959062919 3:101632441-101632463 ACTTTGGTTTAGAAAGGGGATGG - Intergenic
959064371 3:101641901-101641923 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
959164272 3:102757763-102757785 TATTTTCTGTAAAAAGGAGAGGG - Intergenic
959351509 3:105270838-105270860 TTCTTTCTTTGGACAGGAGAAGG - Intergenic
959461391 3:106630004-106630026 ATTTTTCTTTACAAAAGGGGTGG - Intergenic
959625079 3:108440685-108440707 TTTTTTTTTTTGGAAGGAGAGGG - Intronic
959626517 3:108458052-108458074 TATTTTTTTTAAAAAAGGGAGGG + Intronic
959798075 3:110456876-110456898 CTCTGTCTTTGGAAAGGGGAAGG - Intergenic
960163916 3:114380490-114380512 TTTTTTTTTCTGAAGGGGGATGG + Intronic
960185877 3:114638204-114638226 TTTTTCCGTTACAAAGAGGAAGG + Intronic
960236579 3:115289891-115289913 TTTTTTTTTTAAAGAGGGGAGGG - Intergenic
960441015 3:117689031-117689053 ATTTTTATTTAGAAAAGGGATGG + Intergenic
960619188 3:119622766-119622788 TTTTTTTTTTACTAAGGGGTAGG - Intronic
960994887 3:123334045-123334067 CTTTTTCCTTTGAAATGGGAAGG + Intronic
961031205 3:123605579-123605601 TTTTTTCTTTAGAAAAGAATGGG + Intergenic
961290008 3:125839200-125839222 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
961897092 3:130176820-130176842 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
962225032 3:133598781-133598803 CTTCTTGTTTAAAAAGGGGAGGG - Intronic
962225740 3:133606020-133606042 TTTTTTTTTTGGCAAGGGGAAGG - Intronic
962554491 3:136533330-136533352 TTTTTTCTTTAAAAAAAGGTTGG + Intronic
962608714 3:137054921-137054943 TTTTTGCTTTGGAAAGGAGAGGG - Intergenic
962808033 3:138940377-138940399 TTTTTTTTTTTAATAGGGGAAGG + Intergenic
962808658 3:138944578-138944600 TTTTTTCTTCAGATAGGGAGAGG + Exonic
962858005 3:139367257-139367279 TTTTTTTTCTAGAAATAGGAAGG - Intronic
963524888 3:146405142-146405164 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
963525751 3:146411738-146411760 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
963653239 3:148011843-148011865 ACTTTTCTTTTGAAAGGGTATGG + Intergenic
963748103 3:149146246-149146268 TTGTTGCTTTAGAAAGTGGTTGG - Intronic
963967117 3:151385018-151385040 TTTTTTCTTTAGAAAGAGCTAGG + Exonic
964133634 3:153318773-153318795 TTTTTTTTTTAGAAAGAGAGAGG + Intergenic
964471582 3:157062590-157062612 TTTTTTCTTTCAAATTGGGAAGG - Intergenic
964483657 3:157165269-157165291 TTTTTTTTTTAAAGGGGGGATGG - Intergenic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
964783924 3:160372921-160372943 TGTTTATTTTAGAGAGGGGATGG - Intronic
964810153 3:160654517-160654539 CTCTTTCTGTGGAAAGGGGAGGG + Intergenic
964961005 3:162426809-162426831 TTTTTTCTTAAGAAAAGTAATGG + Intergenic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965499569 3:169441735-169441757 TTTTTTTTTTAAAAAAGGGGGGG + Intronic
965621114 3:170643215-170643237 TTTCTTCTTTGTAAAGGAGAGGG + Intronic
966074232 3:175918095-175918117 TTTTTTCTGTTCAAAAGGGATGG + Intergenic
966312985 3:178615508-178615530 CTTTGCCTTTGGAAAGGGGAGGG - Intronic
966387287 3:179412839-179412861 TTTTTTTTTTCCAAAGTGGAGGG - Intronic
966427772 3:179798721-179798743 TCTTTCCGTTTGAAAGGGGAGGG - Exonic
966529664 3:180961452-180961474 TTTTTTTTTTAAACAGGGTATGG + Exonic
966663928 3:182449356-182449378 TTTATTATTTACAAAGGCGATGG + Intergenic
966763105 3:183434379-183434401 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
966958780 3:184912109-184912131 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
967193987 3:187010915-187010937 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
967521794 3:190440615-190440637 TTTTCTCCTTAGAAATTGGAGGG + Intronic
967562171 3:190928658-190928680 TTTTTTTTTTAGACAGGGTCTGG - Intergenic
967585232 3:191205815-191205837 ATTTTTGTTTTGAAAGGGTAGGG + Intronic
967651185 3:191989360-191989382 GTTTTTCTTTAACAAGAGGAAGG + Intergenic
967673907 3:192272899-192272921 TTTTTTCTTCTGAAACTGGAAGG - Intronic
967681394 3:192368098-192368120 TGTTTTTTTTTGGAAGGGGAGGG - Intronic
967689118 3:192453438-192453460 TTTTTTTTTTAAAAAGGGGGGGG - Intronic
967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG + Intronic
968401564 4:303234-303256 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
968766194 4:2470828-2470850 TTTTTTTTTTTGCAAGGTGAAGG + Intronic
968798547 4:2726418-2726440 TTGCCTCTTTAGAAAGGGAAGGG - Intronic
969007271 4:4030378-4030400 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
969530130 4:7725914-7725936 GTGTTTCTCTAGAATGGGGAGGG + Intronic
969646011 4:8429317-8429339 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
969746339 4:9075680-9075702 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
969804947 4:9600228-9600250 ACTTTAGTTTAGAAAGGGGAAGG - Intergenic
970115391 4:12688898-12688920 TTTTTTTTTTAGATAGGGTCTGG - Intergenic
970157456 4:13155342-13155364 TTTTTTTTTTTGAAAGTAGAAGG - Intergenic
970161343 4:13192551-13192573 TTTTTTTTTTAGACAGGGTCTGG + Intergenic
970412650 4:15824427-15824449 TTTTTTTTTTAGTAGGGGTAGGG + Intronic
970671258 4:18398987-18399009 TTTTGTCTTGGGAAAGGGGCGGG - Intergenic
970697295 4:18693235-18693257 TTTTTTTTTTACAAAGGGTATGG + Intergenic
971052213 4:22874329-22874351 TTTCTTCCTTAGCTAGGGGAGGG - Intergenic
971789028 4:31143100-31143122 TTTTTTTTTTGGAGAGGGGTGGG - Intronic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972425640 4:38930032-38930054 ATGTTTCTTTAGAAGGGGGGCGG - Intronic
972471715 4:39411813-39411835 TTTTTTCTTTAAATAGAGAAGGG - Intronic
973042560 4:45489573-45489595 TGTTTTCATTTGTAAGGGGAAGG + Intergenic
973636508 4:52866049-52866071 CTTTTCCTTTAGAGTGGGGAGGG + Exonic
974057897 4:57002808-57002830 TTTTTTTTAAAGAAAGGGGGAGG - Intronic
974060629 4:57031330-57031352 TTTTTTTTTTAAACAGGTGAAGG - Exonic
974266232 4:59589573-59589595 TTTTTTTTTTTGGATGGGGATGG - Intergenic
974340773 4:60612670-60612692 TTTTTTTTTCAGAAAGGTGATGG - Intergenic
974630012 4:64477233-64477255 TTTTTTCTTTAAACAGGGTCTGG + Intergenic
974784149 4:66595999-66596021 TTTTTAATTGAGAAAGGTGAAGG + Intergenic
975172520 4:71248249-71248271 TTTTCTCCTTTGAAAAGGGAAGG + Intronic
975358042 4:73431130-73431152 TTAATTCTTAAGAAAGGAGAGGG - Intronic
975653203 4:76614956-76614978 TTTTTTCTGGAGAAGAGGGAAGG - Intronic
975873592 4:78809387-78809409 TTTTTTCTTGAGACAGGGTCTGG + Intronic
976008660 4:80460799-80460821 TTTTTTCTTTGGCAAGTTGAAGG - Intronic
976501170 4:85791095-85791117 TTGTTTGGTTAAAAAGGGGAAGG - Intronic
976514218 4:85945849-85945871 TTTTTACTTTATAAAGGAAAAGG - Intronic
976626657 4:87191486-87191508 TTTTTACTTTATAAGGGGAAAGG - Intronic
976822839 4:89226378-89226400 TTTTATCTTTAGAGATGAGATGG - Intergenic
977177885 4:93838089-93838111 TTTTGTGTTTAGAATTGGGATGG - Intergenic
977241400 4:94574592-94574614 TTTTTTCTTTTGATATGGTAGGG + Intronic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
977546812 4:98392687-98392709 TTTTTTCTTGAGACAGGGTCTGG - Intronic
978141720 4:105325335-105325357 TTGTTTCTTGAGAAAGTAGATGG - Intergenic
978324174 4:107532830-107532852 TTTTTTCTTCTCAGAGGGGAGGG - Intergenic
978342560 4:107734005-107734027 TTTTCTTTTTAGTAATGGGAGGG - Intergenic
978353934 4:107850368-107850390 TTGTTTGTTTAGAAATGTGATGG + Intronic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
978510887 4:109516177-109516199 TTTGTTTTTAGGAAAGGGGAAGG + Intronic
978511402 4:109523039-109523061 TTTTTTTTTTAAAAAAGGGCTGG + Intronic
978752442 4:112266069-112266091 TCTTTTTTTTGGAAAGGGAAGGG - Intronic
978805101 4:112791498-112791520 TTTTTTCTTGAGACAGGGTCTGG + Intergenic
979351640 4:119650485-119650507 TGTTTTTTTAAGAAAGTGGATGG + Intergenic
979445922 4:120811028-120811050 TATTTTCTTTACAAAAGAGAAGG - Intronic
979447891 4:120836178-120836200 TTTGTTCTTAAGAAAGAGAAGGG + Intronic
979607908 4:122658324-122658346 TTTTTTTTTTGGTGAGGGGATGG - Intergenic
979646139 4:123071474-123071496 TTTTTTTTTTTGGAGGGGGACGG - Intronic
980318623 4:131238836-131238858 TTTTCAGTTTATAAAGGGGAGGG - Intergenic
980645627 4:135638822-135638844 TTTTTTTTTTAGAAATTTGAAGG + Intergenic
980722739 4:136719226-136719248 ATTTTTCTTTTGCAAGAGGACGG + Intergenic
981298056 4:143156006-143156028 ATCTGCCTTTAGAAAGGGGAGGG - Intergenic
981842070 4:149124172-149124194 TGATTTGTTTAGAAAGAGGAAGG + Intergenic
982176891 4:152714374-152714396 TTTTTTTTTAAGAAAGGAAATGG - Intronic
982342062 4:154310622-154310644 TGTTTTCTGTAGACTGGGGATGG + Intronic
982379552 4:154735227-154735249 TTATTTCTTTTGAAAGGGACTGG - Intronic
982540310 4:156661286-156661308 TTTCTTCACTAGAAAGGGCAGGG - Intergenic
983029165 4:162777674-162777696 ATTTTTATTTAGACAGTGGAAGG + Intergenic
983240650 4:165228375-165228397 TTTTTTTTTTTGAGAGGGGATGG + Intronic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983476989 4:168225383-168225405 TTTTTTCTTTAGAAAGGAAAAGG + Intronic
983479669 4:168257302-168257324 TTTTTTTTTTTGAAGGGCGATGG - Intronic
983570569 4:169203537-169203559 TTTTTTCTTGAGACAGGGTCTGG - Intronic
983659152 4:170115059-170115081 TTTTTTTTTTAATAAGGGGAAGG + Intergenic
983913260 4:173264139-173264161 ATTTTTCTTTTGAAAAGGGAAGG - Intronic
983973018 4:173897297-173897319 TTTTGTTTGTAGAAAGGGCATGG - Intergenic
984043776 4:174771732-174771754 ATTTTAGTTTAGAAAGGGAAGGG + Intronic
984165965 4:176303658-176303680 TTTGTTCCTTAGAAATAGGATGG + Intergenic
984377967 4:178956193-178956215 TTTTTGAATTGGAAAGGGGAAGG - Intergenic
984423760 4:179557644-179557666 TGTTTTCTTTATAAAAGGAATGG - Intergenic
984607031 4:181797122-181797144 ATTTTTCTTTGTAAAAGGGAGGG + Intergenic
984639572 4:182145918-182145940 TTTTTTCTTTTGACAAGAGAAGG - Intronic
985225120 4:187751647-187751669 TTTTTTCTTTAGCAAAGGGAAGG + Intergenic
985385343 4:189440643-189440665 TTTTTTGGTTTGAAAGGAGAAGG - Intergenic
985708408 5:1414602-1414624 TTTTTCCTTGTGAAAGAGGAAGG - Intronic
986082238 5:4407274-4407296 TTTTCTCTTTGGAAAGAGAAAGG + Intergenic
986207179 5:5635939-5635961 TTTATTTTTGAGAATGGGGAGGG + Intergenic
986641607 5:9877227-9877249 CTTATTTTTTAGAAAGTGGATGG + Intergenic
986835759 5:11635265-11635287 TGTTATCTTTAGAAAGAAGAAGG + Intronic
987121271 5:14769603-14769625 TTTTTTCTTTAAAGAAGGGGTGG + Intronic
987389188 5:17360222-17360244 TCTTTTCTTTACAAAGGGTAAGG - Intergenic
987496524 5:18652549-18652571 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
987683330 5:21165324-21165346 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
987936856 5:24478283-24478305 TTTTTTCTTAAGGAGGGAGAGGG + Intergenic
988470657 5:31533893-31533915 TTTTTCCTTTAAAAAGGGATAGG - Intronic
988846140 5:35130187-35130209 TGTTTTCTTTGCAATGGGGAGGG - Intronic
988972231 5:36480867-36480889 TTTTTTTTTAAAAAAGAGGAGGG + Intergenic
989048709 5:37297079-37297101 TTTTTTCTTTTGATAGAGAAGGG - Intronic
989115832 5:37951565-37951587 TTTTTTTTTGAGATGGGGGAGGG + Intergenic
989241378 5:39206506-39206528 TTTTTACTTAAAAAAGGGTAGGG + Intronic
989288460 5:39732201-39732223 TTTTATCTATAAAAAGGGAATGG + Intergenic
989443624 5:41502983-41503005 TCTTTTCTTGAGAAAGGGCCAGG + Intronic
989628275 5:43454221-43454243 TTTTTTTTTTAGGAAGAGCAGGG + Intronic
989790667 5:45396389-45396411 TTTTTTTTTTATAGAGGAGATGG + Intronic
990100908 5:52185369-52185391 TTTTTTATTTAAAAAAAGGAGGG + Intergenic
990336262 5:54775638-54775660 TTTTTTCATTTGTAAGAGGAAGG + Intergenic
990457273 5:56000071-56000093 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG + Intergenic
990778811 5:59334766-59334788 TTTTTTTTTTAGGAATGGGGAGG - Intronic
991025095 5:62020499-62020521 TGGTTTCTTTACAAAGGAGAAGG + Intergenic
991366653 5:65875474-65875496 TTTATTCTATAGAAAGTGGTGGG - Intergenic
991583502 5:68180161-68180183 GGTGTTCTTGAGAAAGGGGAAGG - Intergenic
991631746 5:68663439-68663461 TTTTTTTTTTCAAAACGGGATGG - Intergenic
991711892 5:69416035-69416057 TTTTTTCTTTAAAAATGGATAGG + Intronic
991712178 5:69418650-69418672 TTGTTGATTTAGGAAGGGGAAGG + Intronic
992022036 5:72634348-72634370 GTCTTTCTGTAGAAAGGAGAGGG - Intergenic
992951821 5:81866045-81866067 TTTTTTTTCTTTAAAGGGGAGGG - Intergenic
992984210 5:82210931-82210953 TTCTTTCTTTAGGATGGGGTTGG + Intronic
993187327 5:84636289-84636311 TTTTTTCTTGATAAAGTTGAAGG - Intergenic
993464019 5:88222460-88222482 TTTTTTTCTTAGCAGGGGGAAGG - Intronic
993525047 5:88955022-88955044 TCTTTTCTTAAGAAATGGAAAGG + Intergenic
993623742 5:90198538-90198560 TTTTTCCTTCTGAAAGAGGAAGG + Intergenic
993648507 5:90489267-90489289 TTTTTTTTTTGGAAATGGGATGG + Intronic
993894503 5:93516456-93516478 TACTTTCTTTAGAATGGGAAGGG - Intergenic
994214577 5:97123270-97123292 CTTTTTTTTTGGATAGGGGAGGG + Intronic
994475263 5:100260398-100260420 TTCTTTTTTTGGTAAGGGGAGGG + Intergenic
994652671 5:102548769-102548791 TTTTTGCTTGAGGAAAGGGATGG + Intergenic
994925891 5:106116722-106116744 TTTTTTGTTTAAAGAGGGTAAGG - Intergenic
995234677 5:109814174-109814196 TTATATCTTCAGAATGGGGAGGG - Intronic
995346256 5:111122554-111122576 TTCTTGAGTTAGAAAGGGGATGG - Intronic
995458306 5:112375358-112375380 TTTTTTTTTTAAATAGAGGAAGG - Intronic
995740358 5:115349618-115349640 ATTTTTCATTAGAAAGAAGATGG - Intergenic
995957207 5:117792072-117792094 TTTCTTCTTTAGTAAGTGAATGG + Intergenic
996146153 5:119979577-119979599 TTTTTTTTTAAGAAAAGGGCCGG - Intergenic
996161674 5:120174098-120174120 CTCTGTCTTTAGAAATGGGAGGG + Intergenic
996425624 5:123311054-123311076 TTTTTTTTTTAAAAAAAGGAAGG - Intergenic
996458970 5:123719383-123719405 TTTTTTCCGCAGATAGGGGAAGG - Intergenic
996594540 5:125185626-125185648 TTTTGCCTTTGGAAAGGGGAGGG + Intergenic
996845628 5:127895825-127895847 TTTTTTTTTGAGACAGGGTACGG - Intergenic
996858424 5:128037055-128037077 TTTTTTCTAGTGAAAGGAGATGG + Intergenic
996946208 5:129072099-129072121 TATTTTGTTTGGAAAGTGGAAGG + Intergenic
997090656 5:130852997-130853019 TTTTTTTTTTAGAAATGTAATGG - Intergenic
997132417 5:131290492-131290514 TTTTTTTTTGAGACAGGGTATGG + Intronic
997191805 5:131944966-131944988 ATTTATTTTTAAAAAGGGGAAGG - Intronic
997194803 5:131971812-131971834 GTTTATCATTAGGAAGGGGAAGG - Intronic
997478590 5:134165028-134165050 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
997547922 5:134725602-134725624 TTTTTTCTTTGTTAAGGGAAAGG + Exonic
997832712 5:137164826-137164848 TTCTACCTTTGGAAAGGGGAGGG + Intronic
997959820 5:138311593-138311615 ATTTTCTTTTAAAAAGGGGAGGG + Intronic
997981745 5:138471858-138471880 TTTTTTTTTAAGAGATGGGAGGG + Intergenic
998191852 5:140031999-140032021 GTTTTTGTTTTGAAAGGGGGTGG - Intronic
998695265 5:144631055-144631077 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
998705428 5:144753816-144753838 ATTTTTCTTTGGAAATTGGAGGG + Intergenic
998918537 5:147042228-147042250 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
998974368 5:147628013-147628035 TTTTTTTTTTTTAAAGGAGATGG + Intronic
999345700 5:150817184-150817206 CTCTTCCTTTGGAAAGGGGAGGG + Intergenic
999679447 5:154042602-154042624 TTTATTCTTTGCAAAGGGTAGGG + Intronic
999791010 5:154939248-154939270 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
999821716 5:155235186-155235208 TTTTTTCTTTTTGAGGGGGACGG - Intergenic
999868837 5:155729184-155729206 TTTTCTCCTTAGGAAGCGGAAGG - Intergenic
1000456462 5:161455540-161455562 TTTTTTTTTGAGACAGGGTACGG + Intronic
1001060877 5:168487359-168487381 TTTTTTTTTTTGTAGGGGGACGG - Intronic
1001063618 5:168517023-168517045 TTTTTTTTTTTGAAATGAGACGG + Intronic
1001363167 5:171108217-171108239 TTTTTTCTTGAGGTGGGGGAGGG + Intronic
1001964848 5:175902973-175902995 TTTTTTTTTTGGCAAGGGGTGGG - Intergenic
1002070433 5:176676230-176676252 TTTTTTCTTGAGACAGGGTCTGG - Intergenic
1002148623 5:177207613-177207635 TTTTTTTTTTAGAGAAGGGGTGG + Intronic
1002165727 5:177344210-177344232 TTTTTTTTTTAGAGATGGGGGGG - Intronic
1002252104 5:177936215-177936237 TTTTTTTTTTGGCAAGGGGTAGG + Intergenic
1002390556 5:178908609-178908631 TTTTTTTTTTTGGTAGGGGAAGG - Intronic
1002553094 5:180012199-180012221 TTTTTCCGCTAGAAAGAGGAAGG + Intronic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003773752 6:9336690-9336712 TTTTTTTTTTGGAGCGGGGATGG - Intergenic
1003970342 6:11293110-11293132 TATTTGCTGTAAAAAGGGGAAGG + Intronic
1003996377 6:11545044-11545066 ATTTTTATTTAGAAAAGGGCAGG + Intronic
1004192832 6:13479050-13479072 TTTTTTTTTTGGTAAAGGGATGG - Intronic
1004343805 6:14830199-14830221 TCTTTTCTTTAGAGAGGAAAAGG - Intergenic
1004789612 6:19009964-19009986 TTTTTTCTTTCCAAAGGAGTTGG + Intergenic
1004989610 6:21122815-21122837 TTTTTTTTTTGGTAGGGGGAGGG + Intronic
1005091076 6:22057541-22057563 TTTTTTTTTTGGCAGGGGGAAGG + Intergenic
1005201591 6:23351066-23351088 TTTTTTTTTCAGAAAGAGGGAGG + Intergenic
1005222263 6:23599928-23599950 TTTATTCATTAGAAAGGTAAAGG - Intergenic
1005305788 6:24513087-24513109 TTTTTTCTTGAGACAGAGGCTGG + Intronic
1005307565 6:24528711-24528733 TTTTTTCTTGAGATGGAGGATGG + Intronic
1005559569 6:27024470-27024492 TTTATTCTCCAGAAAGGGTAGGG - Intergenic
1005561728 6:27047642-27047664 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1005578558 6:27212311-27212333 TTTTTTCTTTTGAGACGGGCAGG + Intergenic
1005737946 6:28766313-28766335 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1005739394 6:28776094-28776116 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1006063382 6:31442327-31442349 CTTTTTCTTTATAAGGGGGGGGG + Intergenic
1006279217 6:33034641-33034663 TTTTTTCTTTTAAATAGGGATGG + Intergenic
1006741486 6:36312264-36312286 TTGTTTTTTTAGGAAGGGGATGG - Intergenic
1006754620 6:36404641-36404663 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1007133552 6:39499334-39499356 TTTTTTTTAAAGAAAGGGGAGGG + Intronic
1007405598 6:41634482-41634504 TCTTTTCTTCAGGAAGGGGGAGG + Intergenic
1007772970 6:44205966-44205988 TTTTTTTTTGAGAAAGGGTCTGG - Intergenic
1007941041 6:45781978-45782000 TTTTTGGCTAAGAAAGGGGAAGG + Intergenic
1007951753 6:45878728-45878750 TGATTTCTTTAGAAAAGAGAGGG + Intergenic
1008478138 6:51955198-51955220 TTTTTTTTTTAAAAAAGGGAGGG + Intronic
1008593889 6:53021784-53021806 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1008601302 6:53098582-53098604 TTTTTTCTTTTAATAAGGGATGG - Exonic
1008707497 6:54181243-54181265 TTTTGCCTGTGGAAAGGGGAGGG - Intronic
1008840956 6:55903851-55903873 TTTTTTTTTTTGAAATGGGAAGG - Intergenic
1009703162 6:67209721-67209743 TTTTTTCTTTGAAAACGTGATGG + Intergenic
1009793868 6:68440417-68440439 TTTTTACTATGGAAAGGTGAGGG + Intergenic
1009912235 6:69944731-69944753 TTCTTTTTTTATAAAGGTGATGG + Intronic
1009918929 6:70031907-70031929 TTTTTTCTTTAACTAGGTGAAGG - Intronic
1010016252 6:71107929-71107951 ATTTGGCTTTAGAAAGGGGCGGG - Intergenic
1010143729 6:72641695-72641717 TATTATCATTAGAAAGGTGATGG + Intronic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010176981 6:73040014-73040036 TTTTTTTTTTAAGAAGGTGAGGG - Intronic
1010219559 6:73436496-73436518 CTTTTATTTTAAAAAGGGGATGG - Intronic
1010730581 6:79386575-79386597 TTTTTTCTTTAGGAAAGGGTGGG - Intergenic
1010785804 6:79999708-79999730 TTGTATATTTAGAAAAGGGAAGG - Intergenic
1011223968 6:85086724-85086746 TTTTTTTTTTTGAAAGAGTAAGG - Intergenic
1011548634 6:88508065-88508087 TTTTTTCTCAAGAAAGGGTGAGG - Intergenic
1011584011 6:88904575-88904597 TTTTTTTTTTAGAAAGGGCTAGG + Intronic
1011922871 6:92603427-92603449 TTTTTTTTTTGGTATGGGGAAGG - Intergenic
1012000631 6:93650348-93650370 CTTTATATTTACAAAGGGGAAGG + Intergenic
1012049980 6:94328958-94328980 TTCTGTCTTTTAAAAGGGGAAGG + Intergenic
1012761675 6:103310156-103310178 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1012779129 6:103534657-103534679 TTTGCGCTTTAGAGAGGGGAAGG - Intergenic
1013647393 6:112158870-112158892 TTTTTTCTTTAGAATGCGTCAGG - Exonic
1013782120 6:113740373-113740395 ATTTTTCTTTTAAAAGGGTATGG + Intergenic
1013952005 6:115794395-115794417 TTTTTTCTTTTGAAGTGGGTAGG - Intergenic
1014120051 6:117714376-117714398 TTTTTTCTTCACACAGGGCAGGG - Intergenic
1014479560 6:121919054-121919076 TTTGCTCTTTAAAAAGGGAAAGG + Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1014812503 6:125902486-125902508 TTTTTTTTTTAAAGTGGGGATGG + Intronic
1015115623 6:129646048-129646070 TTTTTTCTTTACAAAGAGGTGGG + Intronic
1015162474 6:130168812-130168834 TTTTTTCTTGAGACAGGGTCTGG + Intronic
1015750891 6:136557812-136557834 TTGTGTCTTTAAACAGGGGAGGG - Exonic
1015758394 6:136631522-136631544 TTTTTTTTTTAGACAGGGTCTGG + Intronic
1015842671 6:137490825-137490847 TTTATTATTTAGAAAGGGGAGGG - Intergenic
1015999815 6:139030534-139030556 TTTATTATTTAGGAAGGAGAGGG - Intronic
1016062840 6:139648126-139648148 TTTTTTCCTGAGAACTGGGAGGG - Intergenic
1016291367 6:142531745-142531767 TTTTGTCCTAAGAAAGTGGATGG - Intergenic
1016823827 6:148370085-148370107 TTTTCTCTTTTGTAAGTGGAAGG + Intronic
1017268273 6:152476855-152476877 TTTTTTTTTTAGATAGGGTCTGG - Intronic
1017589637 6:155964792-155964814 TTTTTTTTTTTACAAGGGGAAGG + Intergenic
1017605646 6:156129506-156129528 TTTTTTTTTTTGCAAGGGGGTGG + Intergenic
1017912901 6:158809935-158809957 TTTTTACTTTAGGATGGGGTAGG - Intronic
1018146101 6:160890499-160890521 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1018247399 6:161836036-161836058 TTTTTTCTTTAAAAAGGGGGTGG + Intronic
1018270796 6:162075466-162075488 TTTATTTTTAAGAAAGGGAAAGG + Intronic
1018591006 6:165422050-165422072 TTCTTTCTTTAGACAGGGTCTGG - Intronic
1018997473 6:168720950-168720972 TTTTTTTTTGAGGACGGGGATGG + Intergenic
1019293257 7:260796-260818 GTTTTTCTTTGGAGAGGGGGTGG - Intergenic
1019713498 7:2528014-2528036 CTGTTTTTTTTGAAAGGGGATGG + Exonic
1020032426 7:4942269-4942291 TTTTTTCTGTAGAGATGGGGGGG + Intronic
1020327776 7:6988495-6988517 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1020415168 7:7937283-7937305 TTTTTTTTTTTGAAGGAGGACGG + Intronic
1020504592 7:8967943-8967965 TATTTTCTTTAAAAATGGAAAGG - Intergenic
1020519928 7:9173082-9173104 TTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1021095850 7:16535175-16535197 TTTCTTTTTTAGAAAGGGTTTGG - Intronic
1021417569 7:20406012-20406034 TTTATTCTTTAAAAAGGTGGTGG - Intronic
1021650727 7:22830550-22830572 TTTTTTTTTTTGGAAGGGGTAGG + Intergenic
1021650728 7:22830551-22830573 TTTTTTTTTTGGAAGGGGTAGGG + Intergenic
1022171748 7:27838278-27838300 TTTTTCCTCTACAAAGGGCAGGG + Intronic
1022613594 7:31904639-31904661 TTTTTTCTTTAGAGAAATGATGG - Intronic
1022759211 7:33328961-33328983 TTTTTTCTTAAAAAAGGATAAGG + Intronic
1023031651 7:36094906-36094928 TAATTTCTTTAGAAAGGAAAAGG + Intergenic
1023300322 7:38763633-38763655 TTTTTACTTTAAAAATGTGAGGG + Intronic
1023377493 7:39572712-39572734 TATTTTCATTAGAAAAGGGAAGG - Exonic
1023431618 7:40098382-40098404 TTTTTTCTTTTTTTAGGGGAAGG + Intergenic
1023450477 7:40279007-40279029 TTTTTTTTTTAGAGATGGGGGGG + Intronic
1023610081 7:41964072-41964094 TTTTTTTTTTAAAAAGAGGGTGG + Exonic
1023943909 7:44788171-44788193 TTTTTTTTGTAGAGATGGGAGGG + Intergenic
1023949003 7:44826282-44826304 TTTTTTCCTATGGAAGGGGAAGG - Intergenic
1024068980 7:45769710-45769732 TTTTTTCTAGAGATAGGGGGAGG + Intergenic
1024885833 7:54141133-54141155 TTTGGTATTTGGAAAGGGGAAGG - Intergenic
1026358839 7:69584071-69584093 TGTTTTCTTTGGCAGGGGGAGGG - Intergenic
1026375107 7:69742120-69742142 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
1026399383 7:69993814-69993836 TTCTTTCTACAGATAGGGGAAGG + Intronic
1026577786 7:71588144-71588166 TTGTTTTTTTAGAAAGAGTAAGG + Intronic
1026746734 7:73018954-73018976 TTTTTTTTTTTGAGAGGGGTTGG + Intergenic
1026750386 7:73047097-73047119 TTTTTTTTTTTGAGAGGGGTTGG + Intergenic
1026754033 7:73075207-73075229 TTTTTTTTTTTGAGAGGGGTTGG + Intergenic
1026757684 7:73103243-73103265 TTTTTTTTTTTGAGAGGGGTTGG + Intergenic
1026825179 7:73577253-73577275 TTTTTTTTTTTGCAGGGGGACGG - Intronic
1027004760 7:74683846-74683868 TTTTTTCTTTGGTGGGGGGAAGG - Intronic
1027032838 7:74903532-74903554 TTTTTTTTTTTGAGAGGGGTTGG + Intergenic
1027089719 7:75290244-75290266 TTTTTTTTTTTGAGAGGGGTTGG - Intergenic
1027093364 7:75318172-75318194 TTTTTTTTTTTGAGAGGGGTTGG - Intergenic
1027097007 7:75346139-75346161 TTTTTTTTTTTGAGAGGGGTTGG - Intergenic
1027221224 7:76215411-76215433 TTTTTTTTTTAGACAGGGTCTGG + Intronic
1027322341 7:77021549-77021571 TTTTTTTTTTTGAGAGGGGTTGG + Intergenic
1027515078 7:79131866-79131888 TTTTTTTATTTGAAAGGGTACGG - Intronic
1027522144 7:79222798-79222820 TATTTTCATGAGAAAGGAGAGGG + Intronic
1027885334 7:83897453-83897475 TTTTTTTTTTAGATAAGGAATGG + Intergenic
1028118401 7:87028279-87028301 GTTTTTATTTAGCAAGGTGAAGG - Intronic
1028155680 7:87426617-87426639 TTTTTTCTTTACAAAGAGTATGG + Intronic
1028312720 7:89359168-89359190 TATTTTCTTTTGGAGGGGGAGGG + Intergenic
1028368242 7:90060213-90060235 TTTGTTCTTCAGACTGGGGAGGG - Intergenic
1028533842 7:91869042-91869064 TTTTTTTTTTTAATAGGGGAAGG - Intronic
1028557403 7:92138574-92138596 TTTTTTTTTTTTAATGGGGAGGG - Intronic
1028579926 7:92398039-92398061 TTTTTCCTTTAGCATGGGCATGG + Intronic
1029142643 7:98422458-98422480 TATTTTTTTTAGTAAGTGGATGG - Intergenic
1029398117 7:100323124-100323146 TTTTTTTTTTTGAGAGGGGTTGG - Intergenic
1029875960 7:103752029-103752051 TTTTTTATTTACAAAGGCAATGG + Intronic
1030007136 7:105130791-105130813 TTTTTTTTTTGGAAAGGGGCAGG - Intronic
1030031794 7:105376537-105376559 TTTTTTTTTTGGTGAGGGGAGGG + Intronic
1030110027 7:106019056-106019078 TTTTTACTTTACTAATGGGAAGG - Intronic
1030507619 7:110444819-110444841 TTTTCTTTTTTGAAGGGGGATGG - Intergenic
1030591739 7:111490289-111490311 TTTTTTTTTTAGAGATGGGAGGG + Intronic
1030860300 7:114616900-114616922 TTTTATTTTTAGAGATGGGAGGG - Intronic
1030944839 7:115705097-115705119 TTTTAATTTTATAAAGGGGAAGG - Intergenic
1030967449 7:116010220-116010242 TATTTTCTTTAATAAAGGGAGGG + Intronic
1031108077 7:117570180-117570202 TTTTTTTTTAAGTAAGGAGATGG - Intronic
1031200033 7:118670628-118670650 TTTTTTCTTGAGACGGAGGACGG + Intergenic
1031228752 7:119076576-119076598 TATTTTCTATAGAAAGTAGAGGG + Intergenic
1031231566 7:119114220-119114242 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1031269029 7:119621322-119621344 TTATTTGTCTAGAAATGGGAAGG - Intergenic
1031374697 7:121009593-121009615 TTTTTTTTTGAGACAGGGGCTGG - Intronic
1031797403 7:126193528-126193550 TTTTATTTCTAGAAAGGGCAAGG - Intergenic
1032091146 7:128912275-128912297 TTCTTTCTGTAAAATGGGGATGG - Intergenic
1032297520 7:130653952-130653974 TTTTTTCTTTAAATTGGGGTGGG - Intronic
1032340955 7:131072416-131072438 TATTTTCTTTCCAAAGGAGAGGG + Intergenic
1032674125 7:134112840-134112862 TTTTTTTTTTGGTATGGGGAGGG - Intergenic
1032716671 7:134514632-134514654 TTTATTATTTACAAAGGGGATGG - Intergenic
1033144772 7:138861678-138861700 TTTTTTTTTTAGAGATGGGGGGG - Intronic
1033171918 7:139092004-139092026 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1033238003 7:139653677-139653699 TTTTTTCTTTCCAAAGGTGGGGG + Intronic
1033801962 7:144912249-144912271 CATTTTCTTTAACAAGGGGAAGG + Intergenic
1033811664 7:145020831-145020853 CTTTTTCTGTAAAACGGGGATGG + Intergenic
1033881081 7:145884833-145884855 TTATTTCTTTACAAAGGTGGAGG + Intergenic
1034027074 7:147717100-147717122 TTTTTTCTTTAGAAATAGAAAGG - Intronic
1034080411 7:148272102-148272124 TGTGATCTTTATAAAGGGGATGG + Intronic
1034496010 7:151422887-151422909 GCTTTGGTTTAGAAAGGGGAGGG + Intergenic
1035162943 7:156964571-156964593 TTTTTTCTTTTTAAATGAGATGG - Intronic
1035298317 7:157879593-157879615 TTTTTTCCTTTAAAAAGGGAGGG + Intronic
1035298318 7:157879594-157879616 TTTTTCCTTTAAAAAGGGAGGGG + Intronic
1035403305 7:158582544-158582566 TTTTTTTTTTTGAGAGAGGACGG - Intronic
1036131178 8:6111725-6111747 TTTTTTTTTGAGAAAGGGTCTGG - Intergenic
1036238551 8:7063500-7063522 TTTTTTTTTTTTAAAGAGGATGG + Intergenic
1036368842 8:8145598-8145620 ACTTTCGTTTAGAAAGGGGAGGG - Intergenic
1036882047 8:12520044-12520066 ACTTTCGTTTAGAAAGGGGAGGG + Intergenic
1036944296 8:13080229-13080251 ATTTTTTTTTTTAAAGGGGAGGG - Intergenic
1037034180 8:14144889-14144911 GTTTGTCTTTGGAAAGGGAAGGG + Intronic
1037244045 8:16811261-16811283 ATTTTCCTTTAGAATGGGAAAGG - Intergenic
1037279772 8:17226045-17226067 TTTTTTTTTTTGAAAAGGGCAGG + Intergenic
1037456650 8:19071054-19071076 TTTTTTTTTTGGAAGGGGGTAGG + Intronic
1037609796 8:20466464-20466486 TTTTTTTTTTAGAGAAGGAAAGG + Intergenic
1037748345 8:21663708-21663730 TTCTTTCTTTTGATAGGGCAGGG + Intergenic
1037762241 8:21749228-21749250 TTTTTTTTTTTGCAGGGGGAGGG - Intronic
1038640395 8:29319949-29319971 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1038662751 8:29511330-29511352 TTGTTGCTTTAGGAAAGGGATGG + Intergenic
1038760773 8:30383352-30383374 TTTTTTTTTTAGAAAAATGAGGG - Intergenic
1038775991 8:30531128-30531150 TTTTTTTTTTAATTAGGGGACGG - Intronic
1038871004 8:31492600-31492622 GTTTTGCTTTAGTAAGGAGAGGG + Intergenic
1038889174 8:31699699-31699721 TTTTTTTTTTAAAAAAAGGAAGG - Intronic
1039002282 8:32995091-32995113 CTCTGCCTTTAGAAAGGGGAGGG - Intergenic
1039016450 8:33154806-33154828 CTTTTTCTTTAGCAAGGGACAGG + Intergenic
1039095933 8:33885431-33885453 TTTTTTCTTTAGGAGAGAGAGGG + Intergenic
1039481978 8:37880756-37880778 TTTTTTTTTTTGAAAGGGATAGG - Intronic
1039508699 8:38071645-38071667 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1039699161 8:39944760-39944782 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1039841869 8:41299487-41299509 TTTTTTTTTTATAAAGGAGAAGG - Intronic
1040095756 8:43440721-43440743 TTCTTCCTTTGGAAAGGGGAAGG + Intergenic
1040851268 8:51902387-51902409 TTTTTTTTTTTGCAGGGGGAGGG - Intergenic
1040906212 8:52472199-52472221 TTTTTTCTTTTGTAGAGGGAGGG - Intergenic
1040949988 8:52928511-52928533 TTTTTTCTTGGGAAAAGGGATGG - Intergenic
1041044520 8:53878427-53878449 TTTTTCTTTTGGAAAGTGGAGGG - Intronic
1041269754 8:56099815-56099837 TTTTGACTTTAGAAAGTGGCTGG + Intergenic
1041493678 8:58462837-58462859 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1041497551 8:58503437-58503459 TTTTTTTTTTTTAAAGGGAAAGG + Intergenic
1041875323 8:62681330-62681352 TTTTTTCTTTAGGAAGGGAAAGG - Intronic
1042032347 8:64490115-64490137 TCGTTTCTTCAGAAAAGGGAAGG + Intergenic
1042123472 8:65512969-65512991 GGTTTGCTTCAGAAAGGGGAAGG - Intergenic
1042290242 8:67163344-67163366 TTTTTTTTTAAGAAAGGGAGAGG + Intronic
1042885054 8:73539837-73539859 TTTTTTTTTTTGGATGGGGATGG - Intronic
1043237755 8:77890289-77890311 TTTTTTTTTTAGATTGGGGATGG - Intergenic
1043669468 8:82863892-82863914 TTATTCTTTTAGAAGGGGGAAGG - Intergenic
1044126839 8:88469273-88469295 TATTTTCTCTAGGAAGAGGAAGG - Intergenic
1044347938 8:91128237-91128259 TTCTTTCTTTAGAGATGAGAAGG - Intronic
1044510978 8:93078520-93078542 TTTTTTTTTTTGAAAGGAGAGGG + Intergenic
1044549095 8:93492551-93492573 TTTTTTTTTTAGCAGAGGGAAGG - Intergenic
1044631154 8:94279815-94279837 TTTTATCTTTAGGGAAGGGAGGG - Intergenic
1044867932 8:96590639-96590661 TTTTTATTTTTTAAAGGGGAAGG + Intronic
1044975609 8:97662338-97662360 TTTTTTTTTAAAAAGGGGGAGGG - Intronic
1044975610 8:97662339-97662361 ATTTTTTTTTAAAAAGGGGGAGG - Intronic
1044988972 8:97778742-97778764 ACTTTTGTTCAGAAAGGGGAGGG - Intronic
1045325593 8:101115482-101115504 TTCTTTCCTGATAAAGGGGAAGG - Intergenic
1045442070 8:102224092-102224114 TTTTTTCTTAACATAGGGCATGG + Exonic
1045615238 8:103901250-103901272 TTATTTCTTTAGCAAATGGAGGG + Intronic
1045805393 8:106154910-106154932 TTTTTTCTTTTGGAAGGCCAAGG + Intergenic
1045941295 8:107741410-107741432 TTTTTTTTTTTGGCAGGGGATGG + Intergenic
1046211292 8:111080627-111080649 CTCTTCCTTTAGAATGGGGAGGG - Intergenic
1046337479 8:112808746-112808768 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1046474494 8:114723990-114724012 TTTTCTCTCTGGAAAGGAGATGG + Intergenic
1046566693 8:115910903-115910925 TTTTTTTTTGAGAAAGGGTCTGG - Intergenic
1047271348 8:123362288-123362310 TTTTTTTTTTAGATAGAGGCAGG - Intronic
1047394904 8:124488002-124488024 GTTTTTCTTTAGAAATGGGTGGG + Intergenic
1047827752 8:128595948-128595970 TTTTTTCCTGAGAAATGGAAGGG + Intergenic
1047977807 8:130148844-130148866 TTTTTTCTTGAGACAGGGCCTGG + Intronic
1048100127 8:131342059-131342081 TTTTTTCTTTTGAAGGCAGAAGG - Intergenic
1048153074 8:131912990-131913012 TTTTTTTTTTTGAAAGGAGGAGG + Intronic
1048398911 8:134044838-134044860 TTGGTTCTTTAGATAAGGGAAGG + Intergenic
1049020574 8:139955121-139955143 TTTTTTCTTGTGAAAGGGGTCGG + Intronic
1049095970 8:140548302-140548324 TTTTTTTTTTAGACAAGGGCTGG - Intronic
1049830161 8:144695652-144695674 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1050070210 9:1802872-1802894 TTTTTTCCTCCAAAAGGGGATGG + Intergenic
1050288816 9:4131921-4131943 TATTTTCTTTAGAAAGAGAATGG - Intronic
1050541813 9:6676845-6676867 TTTCTTTTTAAGAAAGGGTATGG - Intergenic
1050616909 9:7410768-7410790 ATTTCTCTTTAGGTAGGGGAAGG + Intergenic
1050895510 9:10881221-10881243 TTTTTTTTTTAAAAAGGAGGAGG + Intergenic
1051691538 9:19718302-19718324 TTTTTTTTTTAGACAGGGTCTGG + Intronic
1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG + Intronic
1051991030 9:23153208-23153230 CTCTGTCTTTAGAAAGGGGACGG - Intergenic
1052032132 9:23640717-23640739 TTTTTTCCTTAGAGAAGGCAGGG - Intergenic
1052674070 9:31596617-31596639 TTCTCTCCTTACAAAGGGGAAGG + Intergenic
1053243090 9:36512441-36512463 TTTTTTTTTTTTAAGGGGGATGG - Intergenic
1054852577 9:69863873-69863895 TTTTCTCTTTAAAAAAAGGAAGG + Intronic
1054868085 9:70023698-70023720 TTTTGTCTTTATAAATGTGATGG + Intergenic
1054871879 9:70054625-70054647 TTGTTTCTATAGTAAGGGGAAGG + Intronic
1054885140 9:70188775-70188797 TTTTTTTTTTAGAAAGAAGTGGG + Intronic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1055467056 9:76576388-76576410 TTTCTTCTTTTGAAAGGGCTGGG - Intergenic
1055748415 9:79476121-79476143 TTTTTTTTTGAGACAGGGTATGG - Intergenic
1055801702 9:80044374-80044396 TGTTTTTTTTAGAAAAGGAAAGG + Intergenic
1057249919 9:93492890-93492912 TGTTTTCTTTTGAAGTGGGATGG + Intronic
1057352251 9:94308826-94308848 TTTTTTTTTTTGACAGGGTAGGG + Intergenic
1057655391 9:96947252-96947274 TTTTTTTTTTTGACAGGGTAGGG - Intronic
1058017991 9:100057742-100057764 TTTCTTTGCTAGAAAGGGGAAGG - Intronic
1058345956 9:103962780-103962802 TTTTTTTTTCAGAGAGGGGGAGG + Intergenic
1058636198 9:107040949-107040971 TTTTTTAAAAAGAAAGGGGATGG - Intergenic
1058693824 9:107542163-107542185 TTTTTTATTTAGAAAAGACATGG + Intergenic
1059020667 9:110573167-110573189 TTTTTTTTATAGGAAGGGGTGGG - Intronic
1059288162 9:113195870-113195892 TTTTTTCTGTAGAATGGAAATGG - Intronic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1059597065 9:115732457-115732479 TTTTTTTTTTAGAAAGGGCAGGG - Intergenic
1059798777 9:117728672-117728694 TTTTTATTTTAAAAAGAGGAGGG - Intergenic
1059906157 9:118989199-118989221 TTTTGACCTTAGAAAGTGGAGGG + Intergenic
1059921545 9:119166139-119166161 TTTTTTTTTTAGAAAGCAAAGGG + Intronic
1060969230 9:127728784-127728806 TTTCTTCTTTAGACAGGGTCTGG - Intronic
1061106173 9:128532227-128532249 TTTTTTTTTTAGGGAGGAGATGG + Intronic
1061319500 9:129819315-129819337 ATTTTTATTTAAAAAGGGGGTGG + Intronic
1061692089 9:132341456-132341478 ATTTATATTTAGGAAGGGGAGGG - Intronic
1061783519 9:133009323-133009345 TTTGCTTTTTAAAAAGGGGATGG + Intergenic
1062208319 9:135349276-135349298 TCTTTTCTTTAAAATGGGGCTGG - Intergenic
1185485259 X:477138-477160 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1186109594 X:6241808-6241830 TTTTTTTTTTAGAGAGGGTTGGG - Intergenic
1186274153 X:7921838-7921860 TTTCTTCTTTAGAAGTGGGATGG - Exonic
1186307694 X:8281672-8281694 TTTTTTCTTTTGAATAGGCAGGG - Intergenic
1186443590 X:9606916-9606938 TTTGTTCTTTTGAAAGGGAAAGG - Intronic
1186577082 X:10778039-10778061 TTTTTTCTTTAATAAGTAGAAGG + Intronic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1187082993 X:16010902-16010924 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1187353891 X:18548138-18548160 TTTTTTTTTTAAATAAGGGAAGG + Intronic
1187416260 X:19095839-19095861 TTTTTTATTGAGATGGGGGAGGG - Intronic
1187501081 X:19839346-19839368 TTTTTTTTTTAGACAGGGTCTGG + Intronic
1187520788 X:20012094-20012116 GTTTTTCAGGAGAAAGGGGAAGG - Intronic
1187610531 X:20938779-20938801 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1187861450 X:23687481-23687503 TTTTGTATTAAGAGAGGGGATGG - Intergenic
1188042574 X:25386785-25386807 TTTTTTCTTAAGAAGGGGGGTGG + Intergenic
1189826990 X:44929255-44929277 TTTTTTTCTTTGAAAGGGGTTGG + Intronic
1190244530 X:48682591-48682613 TCCTTTCTTTAAAAAAGGGATGG + Intronic
1190579414 X:51876534-51876556 CTTTTTCTTGAGGAAGGAGAGGG - Intronic
1190580721 X:51891507-51891529 TTCTTGCTTTAGCAATGGGATGG + Intronic
1190747047 X:53330443-53330465 TCATTTCTTTAGAAAGGAGGAGG + Intergenic
1191021600 X:55866638-55866660 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1191025315 X:55907920-55907942 TTTTTTGACTAGAATGGGGAAGG - Intergenic
1191214229 X:57919218-57919240 TTTTTTTTTGAGAAGGGAGAAGG - Intergenic
1191703805 X:64071273-64071295 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1191860969 X:65666629-65666651 TTTTTTGTATAGATATGGGAGGG + Intronic
1191924492 X:66295353-66295375 ATCTCTCTTTGGAAAGGGGAGGG - Intergenic
1192016198 X:67334244-67334266 TTTCTTCACCAGAAAGGGGAAGG + Intergenic
1192027194 X:67466272-67466294 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1192420519 X:71025882-71025904 TTTTTTTTGTAGAAATGGGAAGG - Intergenic
1192812614 X:74560374-74560396 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
1192925761 X:75753488-75753510 TTTTTTTTTTCCAAAGGGAAGGG - Intergenic
1193078725 X:77383058-77383080 CTTTGTCTTTGGAAAGGGGAAGG + Intergenic
1193204796 X:78736091-78736113 CCTTTGCTTTAGAAAGGGGAGGG - Intergenic
1193337333 X:80306493-80306515 ATCTGTCTTTGGAAAGGGGAAGG - Intergenic
1193438782 X:81513071-81513093 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
1193504917 X:82330376-82330398 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
1193539680 X:82755977-82755999 TGTTTTGTTAAGAAAGAGGAAGG + Intergenic
1193645250 X:84060450-84060472 TTTTTTCTTTATAACAGGAATGG + Intronic
1193761994 X:85478431-85478453 TTTTTTCCTTAGAAAGATGGTGG - Intergenic
1193886993 X:86994519-86994541 CTCTTTCTTTGGAAAGGAGAGGG + Intergenic
1194000124 X:88418027-88418049 TTTTGTCTTTAGAGAGGTGCTGG - Intergenic
1194229668 X:91306788-91306810 CTCTTTCTTTATAAAGGAGAGGG - Intergenic
1194430293 X:93795174-93795196 ATTTGTTTTTAAAAAGGGGAGGG - Intergenic
1194564191 X:95462607-95462629 TTTTTTTTTTTTAAAGGGAAAGG - Intergenic
1194586159 X:95736613-95736635 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1194697351 X:97070200-97070222 TTTTTTCATTTGTACGGGGAAGG + Intronic
1195100493 X:101550767-101550789 TTTTTGTTCTAGAAAGGGCAAGG - Intronic
1195724177 X:107896956-107896978 TTTCTTCTATAGAATGGGAATGG + Intronic
1195960702 X:110383272-110383294 TATACTCTTTGGAAAGGGGATGG - Intronic
1195976887 X:110536332-110536354 TTTTTTCCTTTAAAAGAGGAGGG + Intergenic
1196226253 X:113170975-113170997 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1196396874 X:115273904-115273926 TTTTTTCTGTACAAAGGATATGG + Intergenic
1196508365 X:116476324-116476346 TTCTGTCTTTGGAGAGGGGAAGG - Intergenic
1196552568 X:117046078-117046100 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1196579124 X:117359013-117359035 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1196591003 X:117485201-117485223 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1196595195 X:117537777-117537799 ATTTTTTTTTAGAAAAGGGAGGG - Intergenic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1196865414 X:120066376-120066398 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1196877680 X:120169904-120169926 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1196881418 X:120201190-120201212 TTTGTTTTTTAGAAAGTGGGTGG - Intergenic
1196991089 X:121329664-121329686 TATTTTCCTTGAAAAGGGGACGG + Intergenic
1197295595 X:124715533-124715555 TTTTTTCTTTATACAGGAGGGGG + Intronic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197334357 X:125193952-125193974 TTTTTTTTTTAAAAAAGAGATGG + Intergenic
1197501664 X:127250257-127250279 TGTTTTGTTTAGAGAGGAGAGGG + Intergenic
1197561971 X:128034809-128034831 TTCTTCCTGTGGAAAGGGGAGGG + Intergenic
1197595378 X:128457765-128457787 TTTTTTCTTTAACAAGCGGCAGG + Intergenic
1197661473 X:129178668-129178690 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1197721545 X:129748061-129748083 TTTTCTCTCTTGAAAGGGGTTGG - Intronic
1197862741 X:130987822-130987844 ATATTTCTTTTGAAAGGGGCTGG + Intergenic
1198333394 X:135643253-135643275 TTTTTTCTAGACAAAAGGGAAGG - Intergenic
1198337293 X:135679264-135679286 CTTTTTCTAGACAAAGGGGAAGG - Intergenic
1198539888 X:137627010-137627032 TTTTTTTTTTTGGAATGGGAGGG + Intergenic
1198718596 X:139590456-139590478 TTTTTTTTTTAGAAAGGCCAAGG - Intronic
1198726802 X:139686635-139686657 TTTTGGCTTTAGCAAGTGGATGG - Intronic
1198841083 X:140858868-140858890 TTTTGCCTGTGGAAAGGGGAAGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199206505 X:145155259-145155281 TTTTTTCTTCAGTCAGGAGAGGG - Intergenic
1199917789 X:152362909-152362931 TTTGTTCTTTAGGATGGGGGAGG + Intronic
1200689795 Y:6295534-6295556 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1200945786 Y:8835493-8835515 TTTTTTCTTGAGAAATGACAAGG + Intergenic
1201045477 Y:9879186-9879208 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1201427356 Y:13867167-13867189 TTTATTCTTTAGAATGGCTAAGG - Intergenic
1201471385 Y:14338848-14338870 TTTTTTCTCTAAAAAGGACAAGG - Intergenic
1201609228 Y:15822612-15822634 TTTTTTCCTTGGCAATGGGAAGG + Intergenic
1201621079 Y:15958593-15958615 CTTTTAATTTAGAAAAGGGAAGG + Intergenic
1201752341 Y:17446707-17446729 TTTTGTCTTTTGAAAGGACATGG - Intergenic