ID: 965357163

View in Genome Browser
Species Human (GRCh38)
Location 3:167690316-167690338
Sequence ATGCAAATGCACTAATGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965357160_965357163 1 Left 965357160 3:167690292-167690314 CCCAAATTTGCATGATACGCATT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 965357163 3:167690316-167690338 ATGCAAATGCACTAATGAAAGGG 0: 1
1: 0
2: 1
3: 30
4: 307
965357161_965357163 0 Left 965357161 3:167690293-167690315 CCAAATTTGCATGATACGCATTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 965357163 3:167690316-167690338 ATGCAAATGCACTAATGAAAGGG 0: 1
1: 0
2: 1
3: 30
4: 307
965357159_965357163 4 Left 965357159 3:167690289-167690311 CCACCCAAATTTGCATGATACGC 0: 1
1: 0
2: 1
3: 2
4: 71
Right 965357163 3:167690316-167690338 ATGCAAATGCACTAATGAAAGGG 0: 1
1: 0
2: 1
3: 30
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965357163 Original CRISPR ATGCAAATGCACTAATGAAA GGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
904872809 1:33631272-33631294 ATGTAAATGAAATTATGAAATGG + Intronic
907746420 1:57218195-57218217 ATGCAAAGGCACCGAGGAAAGGG + Intronic
908803211 1:67902093-67902115 ATGCAAATGCAATAAAAACAAGG - Intergenic
909296645 1:73957494-73957516 ATGAAAATGGACTAATACAAAGG + Intergenic
909305581 1:74071856-74071878 AGATAAATACACTAATGAAAGGG - Intronic
910011896 1:82474566-82474588 ATGCAAATGCAGTAAAAAGAAGG - Intergenic
910502314 1:87906909-87906931 AAGCAAATACACTCATCAAAGGG - Intergenic
911545761 1:99214521-99214543 AAGCAAATGCTCTAAGAAAAGGG + Intergenic
911738646 1:101363654-101363676 ATGTAAATGAACTAATACAATGG + Intergenic
911756694 1:101565932-101565954 ATGCAATTGCATTATTGAAGTGG - Intergenic
915788024 1:158637003-158637025 AAGCAAAGGGACTAATGGAAAGG - Intronic
916913663 1:169382545-169382567 ATCAAAATGAACTCATGAAAAGG - Intronic
917154315 1:171979866-171979888 ATGCAAATTCAGTCATGGAATGG - Intronic
917235503 1:172887904-172887926 ACACAAATGGACTAATGGAATGG - Intergenic
917578942 1:176354659-176354681 ATTCAAATGCACAGATGACAAGG - Intergenic
918580402 1:186120401-186120423 ATACATATGCTATAATGAAATGG - Intronic
918755234 1:188331997-188332019 AAGAAAATGCACTAAGGAAAAGG - Intergenic
918803870 1:189013519-189013541 ATGAAAATGGACTAATACAAGGG + Intergenic
919047501 1:192471773-192471795 ATACACATGCACAAATTAAAGGG + Intergenic
919284957 1:195545331-195545353 ATGAAAATGAGCTCATGAAATGG + Intergenic
919332935 1:196193955-196193977 ATGGGAATGCAATAATGAATAGG + Intergenic
920457574 1:206112884-206112906 ATGCAAATGGACTAACACAAGGG + Intronic
921840648 1:219824761-219824783 ATGAAAATGAACTAATAATATGG - Intronic
922954200 1:229585728-229585750 ATGAAAAGGCACTAACCAAAAGG - Intergenic
924023274 1:239807286-239807308 ATGAAAATCCAATAATAAAAAGG - Intronic
1063829764 10:9939237-9939259 CAGCTAATGCAGTAATGAAAGGG - Intergenic
1064468020 10:15604834-15604856 ATGCAAAGGAAATAATGAGAGGG + Intronic
1066070873 10:31810376-31810398 AAGCAAATGCTTAAATGAAATGG + Intronic
1067219079 10:44329514-44329536 ATGAAAATGGACTAATACAAAGG + Intergenic
1068172718 10:53416782-53416804 ATGAAAATGGACTAATACAATGG + Intergenic
1069023906 10:63520731-63520753 TTGCAGATGCTCTGATGAAAAGG + Intergenic
1071070150 10:81682210-81682232 ATGCAAATTTATTAATGAACAGG + Intergenic
1071318473 10:84427465-84427487 TTGCACATGCAATATTGAAAAGG - Intronic
1071324700 10:84501542-84501564 ATACAAATAAACCAATGAAATGG - Intronic
1071435031 10:85640854-85640876 ATGCAAATGCAGGAAGAAAATGG - Intronic
1073685141 10:105744153-105744175 ATGAAAATGTTCTGATGAAATGG + Intergenic
1073720511 10:106164817-106164839 ATGCAAATGCATTAAGGGCAGGG + Intergenic
1073840763 10:107496228-107496250 AAGAAAATGCTCTAAGGAAAGGG - Intergenic
1073992204 10:109274839-109274861 ATGCAAATGCCCTAGGGAAGGGG - Intergenic
1074252805 10:111769587-111769609 ATTCAAATGCTCTAATGGCAAGG + Intergenic
1075378933 10:122002736-122002758 ATGCAAATAAAAAAATGAAATGG - Intronic
1077739053 11:4824763-4824785 GTGCTAATGCACTACTGAGACGG - Intronic
1079327820 11:19509508-19509530 ATGCAAATGCACTGAAGATTTGG + Intronic
1080060505 11:27951608-27951630 AAGGAGATGCACAAATGAAATGG - Intergenic
1081239276 11:40683010-40683032 ATGCAAAAGAAATAAAGAAACGG + Intronic
1081267773 11:41048128-41048150 AAACAAATGTACTCATGAAAAGG + Intronic
1081303351 11:41480919-41480941 ATGACAAAGCACTAACGAAAGGG - Intergenic
1081322340 11:41706411-41706433 AAGTAAATGCTCTAATAAAAGGG + Intergenic
1082062619 11:47873632-47873654 ATGCAAATGAATGAATGAGAAGG - Intergenic
1084119916 11:67062927-67062949 ATGAAAATGCAGGAATGAAGAGG - Intronic
1086530225 11:87776504-87776526 AGGTAAATGCACAAAAGAAAAGG + Intergenic
1087190968 11:95254079-95254101 AGGCAAATGAACTAATCAGAAGG + Intergenic
1088002113 11:104894805-104894827 ATGCAAATTGACTAATGGATTGG - Intergenic
1089441128 11:118518075-118518097 ATACAATTACACTTATGAAATGG + Intronic
1091419159 12:320127-320149 ATCAAAATGCTCTTATGAAATGG + Intronic
1091940991 12:4481836-4481858 CTGCAAATTCAATAAGGAAAGGG + Intergenic
1092799724 12:12152324-12152346 ATGAAAATGAACTAATGCAGTGG + Intronic
1093969134 12:25358526-25358548 CTGGAAATGCAGGAATGAAACGG + Intergenic
1094045739 12:26164660-26164682 ATACAAATGCAATATAGAAAAGG - Intronic
1095516251 12:43009010-43009032 ATGCAAAAGTACAAATGAATGGG - Intergenic
1098712732 12:73786062-73786084 ATGCAAGAGCACTAATGGAGGGG - Intergenic
1099037069 12:77601830-77601852 ATGCAATTGGACAAAAGAAATGG + Intergenic
1099292972 12:80794853-80794875 ATGTAAATGCTCCAGTGAAAAGG + Exonic
1099806433 12:87526422-87526444 ATGTAAATGCTCTAAGAAAAGGG - Intergenic
1100006878 12:89905288-89905310 ATTCAAATGAGCTCATGAAATGG + Intergenic
1100558288 12:95720372-95720394 ATGCAAATTCCCTAAGAAAACGG + Intronic
1101451635 12:104785091-104785113 ATGCAAATAGACTAATGAGCAGG + Intergenic
1101580310 12:106036905-106036927 ATGAAAATGGACTAATAAAGAGG - Intergenic
1104414416 12:128586070-128586092 ATGCAAAAGAACAAATAAAACGG + Intronic
1105576328 13:21656486-21656508 ATGAAAATGGACTAATACAATGG - Intergenic
1105695620 13:22885916-22885938 ATGCAAATGCCTGGATGAAATGG + Intergenic
1106430874 13:29679320-29679342 ATAAAAATGCACTAGAGAAAAGG + Intergenic
1106512962 13:30427256-30427278 ATACAAATACACTCATGCAAAGG - Intergenic
1109776752 13:67051229-67051251 ATACAAACACACTAATGAAAGGG + Intronic
1110107379 13:71694358-71694380 AGGCCTATGAACTAATGAAAAGG + Intronic
1110406123 13:75152146-75152168 ATGAAAATGGACTAATTCAAAGG + Intergenic
1110433303 13:75451085-75451107 ATGCAAATACGGTAAAGAAATGG - Intronic
1110513584 13:76382466-76382488 ATGTAAATGAACTAAGGAAAAGG + Intergenic
1111312416 13:86506568-86506590 AGTCAAATGCCCTAAAGAAAAGG - Intergenic
1111332911 13:86783554-86783576 ATGCAGATGAACTAATGGATTGG - Intergenic
1111745095 13:92258205-92258227 ATGCAAATTCACTTATAAATAGG + Intronic
1113064341 13:106358521-106358543 ATGAAAATGGACTAATACAAGGG + Intergenic
1114911993 14:27212217-27212239 ATGCAAATGAACTAAGGACCTGG + Intergenic
1115170192 14:30496021-30496043 ATGCAAATGGACTTAGAAAAAGG + Intergenic
1115249165 14:31328521-31328543 ATGAAAATGGACTAATGCAAAGG - Intronic
1115734335 14:36308265-36308287 ATGCAAAGACACTTATGCAAAGG + Intronic
1116323828 14:43504937-43504959 ATGAGAATGCACTTTTGAAAGGG + Intergenic
1117366309 14:55032263-55032285 ATTCAAATCCAATAATTAAAAGG - Intronic
1118059114 14:62116483-62116505 ATGAAAATGCACAAAAGCAAAGG - Intergenic
1118242854 14:64078312-64078334 TGGCAAATGCATTAATGAGAAGG - Intronic
1119222943 14:72924153-72924175 AGGCAAATGTTGTAATGAAAAGG - Intergenic
1120179658 14:81330215-81330237 ATTCAAATGCAATAATGCAGTGG + Intronic
1122572311 14:102713811-102713833 ATGCTAATGCACTAACAAGATGG + Intronic
1123954145 15:25316103-25316125 ATGGAAATGCACTACTGTAAGGG - Intergenic
1124017583 15:25890548-25890570 ATGCAAATGAATATATGAAATGG - Intergenic
1125207375 15:37169422-37169444 ATGAAAATGGACTAATGCAAAGG - Intergenic
1125434955 15:39634789-39634811 ATGCACATGTACTAGTGGAAAGG - Intronic
1125770459 15:42162077-42162099 AAGAAAATGCACAAAAGAAACGG - Exonic
1126161544 15:45618156-45618178 ATCGAAATGCACTGATGAGAAGG - Intronic
1126161566 15:45618875-45618897 ATCGAAATGCACTGATGAGAAGG + Intronic
1126189457 15:45864652-45864674 ATGAAAGTGCAAAAATGAAAGGG - Intergenic
1126901709 15:53321242-53321264 ATGCAAATGCAATTATGGAGAGG + Intergenic
1126942692 15:53783892-53783914 AAGCAAATGCACAAATTACATGG + Intergenic
1127266039 15:57362649-57362671 ATTCAAATGAACTAATGGAGAGG - Intergenic
1127925044 15:63531034-63531056 ATGCGAATGCACTAAGAAAAGGG + Intronic
1128013412 15:64320241-64320263 AAACAAATGCATTAATGAAGAGG + Intronic
1128196443 15:65761031-65761053 ACCCAAAAGAACTAATGAAAAGG - Intronic
1130824631 15:87531757-87531779 ATGAAAATGGACTAATACAAAGG - Intergenic
1133338046 16:5019282-5019304 TTGCAAATGCTCTAAAGCAAGGG - Intergenic
1134113574 16:11531477-11531499 AAGCTAATACACAAATGAAAAGG - Intergenic
1135049487 16:19181028-19181050 AAGCAAATGCCCCATTGAAAGGG + Intronic
1137090475 16:36183910-36183932 ATGCGAATGGAATAATCAAATGG - Intergenic
1137094522 16:36237034-36237056 AATCAAATGCAATTATGAAATGG - Intergenic
1140297801 16:73726082-73726104 ATACAAATAGACTAATGATAAGG + Intergenic
1143927910 17:10389373-10389395 ATGCAAAGGCCCTAAGGCAAGGG - Intergenic
1144141678 17:12355516-12355538 ATGCAAAATGACTAATGATACGG - Intergenic
1144192417 17:12858734-12858756 ATGAAAATGTACTAATACAAAGG - Intronic
1148077368 17:44946336-44946358 AGGGAAATTCAATAATGAAATGG + Intronic
1149089195 17:52758026-52758048 AAACAAATGCTCTAAGGAAAGGG + Intergenic
1150310464 17:64124718-64124740 ATGAAAATGGACTAATACAATGG + Intronic
1153738057 18:8093581-8093603 TTGCAAATGCACAAATAAACTGG - Intronic
1154489870 18:14913063-14913085 AAGAAAATGCACTGATAAAATGG - Intergenic
1155099055 18:22590449-22590471 AGGCAAATGCAACAATGAGAAGG - Intergenic
1155318365 18:24594399-24594421 AAGGAAATGCACTAAGGAAATGG + Intergenic
1155927488 18:31672537-31672559 ATGCTAATGGACTAAAGAAGAGG + Intronic
1155974513 18:32114189-32114211 TTGCAAATACATTACTGAAAAGG - Intronic
1157023081 18:43809660-43809682 ATGAAAATGGACTAATACAATGG + Intergenic
1157401416 18:47391602-47391624 ATGAAGAGGCACAAATGAAACGG - Intergenic
1157841727 18:50965541-50965563 ATGCAAATGGACTAATACAGAGG + Intergenic
1159130427 18:64275173-64275195 AGGTAAATGCTCTAAGGAAAGGG + Intergenic
1159211579 18:65329104-65329126 ATTCAAATGCAAACATGAAATGG - Intergenic
1160232639 18:77059819-77059841 ATGCAAATGCAATAACCAAAAGG + Intronic
1162231412 19:9270222-9270244 AGGGAAATGCACTAATGGGAAGG - Intergenic
1164687956 19:30182225-30182247 ATGAGAATGGACTAATAAAATGG - Intergenic
1165638529 19:37364252-37364274 ATGCAAAGGCACCACTCAAAAGG - Exonic
1166170038 19:41021785-41021807 ATGAAAATGGACTAATACAATGG - Intergenic
925102715 2:1262521-1262543 AAGCAAATGCTCTAAAGATAGGG + Intronic
927409092 2:22805020-22805042 AAGCAAATGCTCTAAGAAAAGGG + Intergenic
927437944 2:23086528-23086550 ATGCAAATGCAGGAGTAAAAAGG + Intergenic
928404961 2:31007766-31007788 ATTTTAATGCACTAAGGAAACGG - Intronic
928591578 2:32821912-32821934 ATCAAAATTCACTAATAAAAGGG - Intergenic
928790750 2:34949601-34949623 AAGCAAATGCTCTAAGAAAAGGG + Intergenic
929008601 2:37419049-37419071 ATGCAAAGGCGCTAATGACTCGG + Intergenic
929323431 2:40575798-40575820 ATACAAATGCACATATAAAAAGG - Intronic
929623971 2:43387466-43387488 GTGCATAGGCATTAATGAAAAGG - Intronic
933076023 2:77927560-77927582 ATGAAAATGGACTAATACAATGG + Intergenic
933130139 2:78662287-78662309 ATCTAAATGCCCTAATGAAAAGG - Intergenic
933139063 2:78770817-78770839 AAGCAAATGCTCTAAGAAAATGG + Intergenic
934072283 2:88395543-88395565 ATGCATATTCACTTATTAAAGGG + Intergenic
935932522 2:108143821-108143843 ATGTAAATACAGTAATTAAAAGG + Intergenic
936829287 2:116622796-116622818 ATGGAAATGAACTCAAGAAATGG + Intergenic
937798160 2:126050176-126050198 GTGCTAATGCAGTATTGAAAGGG - Intergenic
940262625 2:151798105-151798127 ATACACATGCACAAATGAAATGG + Intronic
940459117 2:153940035-153940057 TTGCATATACACTAAGGAAAGGG - Intronic
941430660 2:165409758-165409780 ATGAAAATGGACTAATGCAATGG + Intergenic
941462241 2:165785113-165785135 ACGCTAATGCACTAGTGAAATGG + Intronic
942694956 2:178631194-178631216 AAGCAGATGCACCAGTGAAATGG - Exonic
944385853 2:199164028-199164050 ATGGAAATGCAATAGTGAACTGG - Intergenic
945411982 2:209520709-209520731 AAGCAAATGACCTCATGAAAGGG - Intronic
946673945 2:222137392-222137414 AGGCAAATACAGTAATGAAGAGG - Intergenic
947335222 2:229075597-229075619 ATGCAAATGTACAAATGAGGGGG + Intronic
947429993 2:230019279-230019301 CTGCACTTGCACTAATAAAAAGG + Intergenic
1170185154 20:13580848-13580870 ATAAAAATGCACTAAAGACAGGG + Intronic
1170695514 20:18654444-18654466 ATGAAAATGGACTAATGCAGTGG + Intronic
1173936265 20:46868010-46868032 AAGTAAATGCTCTAATTAAAAGG - Intergenic
1175109498 20:56637011-56637033 ATGCTAACACAATAATGAAAGGG - Intronic
1177387669 21:20428841-20428863 ATGAAAATGGACTAATACAAGGG - Intergenic
1178255226 21:31046219-31046241 AAGCAAATGCTCTAAGAAAAAGG + Intergenic
1178454710 21:32738055-32738077 ATGCAAGTCCAGTAATCAAAGGG + Intronic
1178553927 21:33569564-33569586 AGGCACAGGCACTAATGAAGCGG - Intronic
1178860329 21:36283752-36283774 CTGCACATGAACTAAAGAAAAGG - Intronic
1180132995 21:45839290-45839312 AAGTTAATACACTAATGAAATGG - Intronic
1180556123 22:16576959-16576981 ATGGCACTGCACTAATAAAAAGG - Intergenic
1181362457 22:22348486-22348508 AGGCACATGCACTAATGCAGAGG + Intergenic
1181903398 22:26173587-26173609 ATTCAAATGAATGAATGAAAGGG - Intronic
1182009575 22:26989351-26989373 ATGCACATACACCAATGAAAAGG - Intergenic
1182913228 22:34005075-34005097 ATGAAAATGGACTAATACAACGG - Intergenic
1182983770 22:34697805-34697827 ATGGAAATACACTAAAGATAAGG + Intergenic
1183719905 22:39556833-39556855 ATGCAAATGAACAAATAAAAGGG + Intergenic
1184592536 22:45494641-45494663 ATGAAAATGGACTAATACAAAGG - Intergenic
951353922 3:21641181-21641203 ATGAAAGTGGACTAATGAGAAGG - Intronic
951433951 3:22640366-22640388 ATGCAAATAAACTAGAGAAATGG - Intergenic
951825558 3:26864558-26864580 AAGTAAATGCTCTAAGGAAAAGG - Intergenic
955077641 3:55629043-55629065 ATGCAGATGAACTACTGTAAAGG + Intronic
956579139 3:70791152-70791174 ATGAAAATGTACTAATATAATGG + Intergenic
957178794 3:76849392-76849414 ATGCAAATGGGGTCATGAAAGGG - Intronic
957729175 3:84110195-84110217 AAGCAAATGCTCTAAGAAAAGGG - Intergenic
958132381 3:89444908-89444930 ATGGAAATTCTCTAATGAAAAGG + Intronic
958463465 3:94427887-94427909 TTACAAATACACTAATAAAAAGG + Intergenic
958660150 3:97056659-97056681 ATTCATATGCACTACTGATAAGG - Intronic
958707127 3:97669917-97669939 AGGCAAATGCATTAAGGAAAAGG - Intronic
959341668 3:105139123-105139145 ATGGAAATGATCAAATGAAATGG + Intergenic
959448057 3:106464999-106465021 ATGTAAATGGACTAAATAAAGGG - Intergenic
959843469 3:111005241-111005263 ACTCAAATGCACTTATGGAAAGG + Intergenic
960394272 3:117117227-117117249 ATGCAAATGTATGAATGATAAGG - Intronic
961922053 3:130437429-130437451 ATGCAAGGCCACTAAGGAAAAGG - Intronic
962099050 3:132322693-132322715 AAGCAAAGGCACAAATGAATAGG + Intronic
963353136 3:144176769-144176791 ATGCAATTGTAACAATGAAATGG - Intergenic
964742874 3:159985987-159986009 ATGCTAAGGGAATAATGAAAAGG - Intergenic
965357163 3:167690316-167690338 ATGCAAATGCACTAATGAAAGGG + Intronic
965464396 3:169009710-169009732 ATGCAAATACAAAAATCAAAAGG + Intergenic
966369872 3:179238948-179238970 ATGGCACTGCACTAATAAAAAGG - Exonic
966500626 3:180634952-180634974 TTGAAAATGGACTAATTAAATGG - Intronic
967048592 3:185760935-185760957 ATGCAAATGAACAAAACAAAAGG - Intronic
967466014 3:189806776-189806798 ATGCGAATGCATGAATGTAATGG + Intronic
967602718 3:191408715-191408737 ATTAAAATTCATTAATGAAAAGG - Intergenic
970073470 4:12190441-12190463 AAGCAAATGCTCTAAGAAAAGGG + Intergenic
970106219 4:12588186-12588208 ATACAAATCCACTAGGGAAAAGG + Intergenic
970176692 4:13346541-13346563 ATGCAAATGGACTAACGCAGGGG + Intergenic
970443536 4:16105716-16105738 ATGAAAATGGACTAATACAAGGG - Intergenic
970608059 4:17700458-17700480 ATGTATATGCACAAATAAAAAGG + Intronic
970693878 4:18652624-18652646 ATGCATATGTACATATGAAATGG + Intergenic
970913201 4:21303388-21303410 ATGCAAATACATTGATCAAATGG - Intronic
971653073 4:29304514-29304536 AAGTAAATGCTCTAATAAAATGG + Intergenic
972110837 4:35557263-35557285 ATGCTAAAGCACTAATACAAGGG - Intergenic
972437883 4:39051892-39051914 ATGCAAATTTACTAATCACAGGG + Intronic
972817758 4:42662738-42662760 TTGCAGAAGCACTAAAGAAACGG + Intergenic
976560300 4:86493441-86493463 AGGGAAATGCAATAAAGAAAAGG - Intronic
977556865 4:98495692-98495714 ATGCACATGCAGAAACGAAAAGG + Intronic
977646175 4:99415312-99415334 ATGAAAATACACTAATGCAGTGG + Intronic
977743259 4:100512979-100513001 ATGTAACTTCACCAATGAAAAGG + Intronic
978055298 4:104256280-104256302 ATGGGAATTCACTAATGATATGG - Intergenic
978538241 4:109786001-109786023 ATGAAAATGGACTAATACAATGG + Intronic
979369061 4:119862049-119862071 ATGAAAATGGACTAATGCAGAGG - Intergenic
979599075 4:122566716-122566738 ATGAAAATGGACTAATACAATGG + Intergenic
979781931 4:124662720-124662742 ATGTAAGTGTACAAATGAAATGG + Intergenic
980300113 4:130979507-130979529 TTGAAAGGGCACTAATGAAATGG - Intergenic
980309028 4:131102152-131102174 ATGAAAATGGACTAATACAATGG + Intergenic
980440470 4:132837615-132837637 TTTCAAATACAATAATGAAATGG - Intergenic
980569686 4:134598144-134598166 GTGAAAATGGACTAATGCAATGG + Intergenic
981941287 4:150284017-150284039 ATGAAACTGCAGTAAAGAAATGG + Intronic
982091921 4:151887604-151887626 ATGAAAAGGCTCTAATTAAAAGG - Intergenic
983343418 4:166496219-166496241 ATGTAAAGGCAGTAATGAAACGG + Intergenic
984309348 4:178037019-178037041 ATTAAAATGCACTACTGAGACGG + Intergenic
985108734 4:186525406-186525428 ATGCAAATACATGTATGAAAAGG - Intronic
986067527 5:4249892-4249914 GTGAAAATGGACTAATGCAAAGG + Intergenic
986425164 5:7624098-7624120 ATGCAAATGCACAATAGAAGTGG - Intronic
986913491 5:12586381-12586403 ATGCACATAGACTAATGAAACGG + Intergenic
987489598 5:18560803-18560825 ATTCAAATGCAGAAAAGAAAGGG + Intergenic
988186980 5:27877621-27877643 AAGCAAATGAACTGATGGAATGG - Intergenic
988903059 5:35754710-35754732 AAGCAAATGCCCTAACAAAAGGG + Intronic
989526806 5:42462826-42462848 ATTAAAATGCATTATTGAAATGG + Intronic
990206727 5:53437847-53437869 ATGTAAATCTACTAATGAAAAGG + Intergenic
991146343 5:63309881-63309903 ATAAAAATGCATTATTGAAATGG + Intergenic
991538532 5:67700553-67700575 ATGCTCATACACTAATGAAGAGG + Intergenic
994331563 5:98512246-98512268 AGGAAAATGAACAAATGAAATGG + Intergenic
994516438 5:100778114-100778136 AAGCAAATTCACCAAGGAAAAGG - Intergenic
995518690 5:112978639-112978661 ATTCAAATGAACCACTGAAAAGG + Intronic
995958153 5:117805356-117805378 AAGTAAATGCTCTAATAAAAGGG + Intergenic
996214614 5:120851543-120851565 AAGTAAATGCTCTAAAGAAAGGG - Intergenic
996757750 5:126952373-126952395 ATGCAAATTCACTCATTAAAGGG + Intronic
996946035 5:129068755-129068777 ATGCAAAGGAAGTAAGGAAATGG - Intergenic
997242638 5:132319041-132319063 ATGTAAATCCACTTCTGAAAGGG + Intronic
998324857 5:141271248-141271270 ATGGAAATGGACTAAGGAGAAGG + Intergenic
998350255 5:141495629-141495651 ATGCAAGTAGACAAATGAAAGGG - Intronic
1001461676 5:171920798-171920820 ATGAAAATGCACAGATAAAAAGG - Intronic
1005095918 6:22115650-22115672 ATGCAAAATCATTAAAGAAAGGG - Intergenic
1005285426 6:24321538-24321560 AAGCAAATGCTCTGATAAAAAGG - Intronic
1006202443 6:32306905-32306927 AAGAAAATGCACTAAAAAAATGG - Intronic
1006662894 6:35663635-35663657 GTGCAAAGGCACTGAGGAAAGGG - Intronic
1008245362 6:49164652-49164674 ATGCAAATTCACAGATGAAAAGG - Intergenic
1008861665 6:56156354-56156376 AAGCAAATGCTCTAAGGAAAAGG - Intronic
1010306630 6:74331533-74331555 ATGCAAAAGCATACATGAAAAGG - Intergenic
1010624483 6:78120479-78120501 ATGAAAAGGTACTAATGAATTGG - Intergenic
1010932321 6:81818017-81818039 ATGCTATTGCAATAATGAAGGGG - Intergenic
1011184498 6:84659235-84659257 ATGCAAAACCACTAAAGATAAGG + Intergenic
1012007488 6:93732338-93732360 ATTCTACTGTACTAATGAAAGGG + Intergenic
1012256709 6:97041033-97041055 ATGAAAATGAACTAATACAATGG + Intronic
1013896982 6:115101171-115101193 ATGTAAATGCCCCAATTAAAAGG - Intergenic
1014067974 6:117149642-117149664 ATGTAAATGGACTAATACAATGG - Intergenic
1014086648 6:117353754-117353776 CTGTAAATGAACGAATGAAAGGG + Intronic
1016225978 6:141738337-141738359 ATGAAAATGCAAAAATAAAAAGG - Intergenic
1016631194 6:146234305-146234327 ATGAAAATAAACTAATTAAAAGG - Intronic
1016663983 6:146613065-146613087 ATGCAAAGGCACAAATGAAGGGG - Intronic
1016673063 6:146731026-146731048 ATGTAAATGCTCTAAGGCAAAGG + Intronic
1018514978 6:164569673-164569695 AAGCAAATGCTCTAACAAAAGGG - Intergenic
1020542476 7:9476148-9476170 ATGCAAATTCAATAATATAATGG + Intergenic
1020917231 7:14209953-14209975 ATGCAGGTGCACTAATAAATGGG + Intronic
1021504959 7:21372169-21372191 ATGCAAATGGAATAATGAAATGG + Intergenic
1022907717 7:34872521-34872543 ATGAAAATGGACTAATAAACAGG - Intronic
1022949396 7:35321335-35321357 AAGCTAATGAACTACTGAAAAGG - Intergenic
1022976050 7:35557850-35557872 ATGAACATCCACTAATGCAAGGG - Intergenic
1023334172 7:39151117-39151139 TTCCAAATGCACTACTGAAGTGG + Intronic
1024361402 7:48472876-48472898 ATGAAAATGGATTAATAAAAAGG - Intronic
1027808559 7:82861950-82861972 ATGCAAAAGCAGTACTGAGAGGG + Intronic
1028588809 7:92475837-92475859 ATGCAAATGCATTACAGAGAGGG + Intronic
1029965875 7:104740265-104740287 ATGAAAATGAACAAATGCAATGG + Intronic
1030200336 7:106896599-106896621 ATGCAAGAGCACTAATGCACTGG + Intronic
1030731623 7:112996842-112996864 ATTCAAATTCTCTTATGAAATGG - Intergenic
1030762292 7:113366415-113366437 AAGTAAATGCTCTAAGGAAAGGG + Intergenic
1030878118 7:114841534-114841556 AAGCAGATTCACTAAAGAAAAGG + Intergenic
1031119134 7:117700746-117700768 GTGCAAATGCTGTAATGAATGGG + Intronic
1031597680 7:123666827-123666849 ATGCAGATGCACTAAAGACAGGG + Intergenic
1031661637 7:124432817-124432839 ATGCAAATGAACAAGTGGAACGG - Intergenic
1031783440 7:125998423-125998445 ATGCATATGCACAAAAGAAGGGG + Intergenic
1032731722 7:134649690-134649712 ATCCAAATGCTTTAATGAAGTGG - Intronic
1032767675 7:135014414-135014436 ATGCAAATGATCTTATAAAAGGG - Intronic
1032967067 7:137110209-137110231 ATGCAAGGACACTAAAGAAATGG + Intergenic
1034784725 7:153915409-153915431 ATGCAAATAAGCTCATGAAATGG + Intronic
1039320187 8:36421183-36421205 ATGCAAAAGCAAAAAAGAAACGG + Intergenic
1040588422 8:48765819-48765841 ATTCAAATGCACTCAGCAAATGG + Intergenic
1040678299 8:49778794-49778816 AATAAAATGCACAAATGAAAGGG - Intergenic
1042322764 8:67495346-67495368 CTGCAAATGCATTGAGGAAAGGG + Intronic
1042448057 8:68912117-68912139 AGTCTCATGCACTAATGAAATGG + Intergenic
1042807646 8:72789359-72789381 ATGAAAATGCACTCAAGAATTGG - Intronic
1043628993 8:82303932-82303954 AAGCAAATGCTCTAAGAAAAGGG + Intergenic
1044293137 8:90496148-90496170 ATACACATGCACAAATGAAATGG - Intergenic
1045513888 8:102839469-102839491 TTTCAAGTGCACCAATGAAAGGG - Intronic
1045961050 8:107968873-107968895 ATACATATGCACTACTCAAAGGG + Intronic
1046298948 8:112260182-112260204 ATGCAAATCCATTAATGTTAGGG - Intronic
1050531166 9:6590701-6590723 ATGCAAATGAACTAAAATAATGG + Intronic
1052003354 9:23315787-23315809 ATGCAAAGTCACTAATTATAAGG + Intergenic
1052355341 9:27498715-27498737 AGGCACATGCACCATTGAAAGGG + Intronic
1055224758 9:73983136-73983158 ATGCAAATGTAAAAATAAAAAGG - Intergenic
1055543463 9:77340829-77340851 ATGTAAATGCACCAAAGAGAAGG + Intronic
1056088822 9:83184536-83184558 ATGCTAGTCCTCTAATGAAAAGG + Intergenic
1058086874 9:100757065-100757087 ATGAAAATGGACTAATACAAGGG + Intergenic
1059783544 9:117555296-117555318 ATGCACATACAATAATGGAAAGG + Intergenic
1060455521 9:123791290-123791312 AAGGAAATTCATTAATGAAAAGG + Intronic
1185996149 X:4951634-4951656 ATGCATATGAACAAATAAAAAGG + Intergenic
1186172880 X:6896086-6896108 TCACAAATCCACTAATGAAAAGG - Intergenic
1186647847 X:11526165-11526187 ATTCAAATGCATTAATGAGCTGG + Intronic
1186701739 X:12097657-12097679 ATGCAACTGGAATAATGCAATGG + Intergenic
1187692555 X:21884391-21884413 AAGCAATTTTACTAATGAAAAGG + Exonic
1188700149 X:33249494-33249516 AAGTAAATGCAATAATGATATGG - Intronic
1189673843 X:43441358-43441380 ATGAAAATCCACTAAGCAAATGG - Intergenic
1190650102 X:52561084-52561106 ATGTAAATAGTCTAATGAAATGG + Intergenic
1190680506 X:52823104-52823126 ATGTAAATGGTCTAATGGAATGG + Intergenic
1190954351 X:55177449-55177471 ATGCAAATAGTCTAATGAAATGG - Intronic
1190998131 X:55631868-55631890 ATGTAAATGGTCTAATGGAATGG + Intergenic
1192561019 X:72128132-72128154 AAACAAAAGCGCTAATGAAAAGG + Exonic
1192845462 X:74902733-74902755 ATGCAAATGCATGGGTGAAAGGG - Intronic
1194638653 X:96375873-96375895 ATGCAAATGCCCCAAGGAGAGGG - Intergenic
1195316857 X:103687587-103687609 TTGAAAATGTTCTAATGAAAAGG + Intronic
1196254104 X:113495541-113495563 ATGCCAATGCAGGAATGAAAAGG + Intergenic
1196989992 X:121317836-121317858 GTGAAAATGCACAAATGAAAGGG + Intergenic
1199177396 X:144806826-144806848 ATGAAAATGGACTAATACAATGG - Intergenic
1199653414 X:149970694-149970716 ATGCAAATGAAATATTGAAATGG + Intergenic