ID: 965360715

View in Genome Browser
Species Human (GRCh38)
Location 3:167735200-167735222
Sequence CTGTCAGCCCGCCCCCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 106}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965360715_965360724 3 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360724 3:167735226-167735248 AGAGGAAGGAAGGGGGTGAGGGG 0: 1
1: 0
2: 43
3: 387
4: 2834
965360715_965360729 22 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360729 3:167735245-167735267 GGGGCCTGTGGTGGGGATCCTGG 0: 1
1: 0
2: 2
3: 109
4: 1398
965360715_965360721 -4 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360721 3:167735219-167735241 ACAGAGCAGAGGAAGGAAGGGGG 0: 1
1: 1
2: 16
3: 184
4: 1420
965360715_965360723 2 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360723 3:167735225-167735247 CAGAGGAAGGAAGGGGGTGAGGG 0: 1
1: 0
2: 22
3: 305
4: 2688
965360715_965360730 23 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360730 3:167735246-167735268 GGGCCTGTGGTGGGGATCCTGGG 0: 1
1: 0
2: 2
3: 42
4: 355
965360715_965360727 14 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360727 3:167735237-167735259 GGGGGTGAGGGGCCTGTGGTGGG 0: 1
1: 0
2: 9
3: 105
4: 875
965360715_965360722 1 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360722 3:167735224-167735246 GCAGAGGAAGGAAGGGGGTGAGG 0: 1
1: 1
2: 23
3: 212
4: 2109
965360715_965360731 24 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360731 3:167735247-167735269 GGCCTGTGGTGGGGATCCTGGGG 0: 1
1: 0
2: 2
3: 44
4: 422
965360715_965360720 -5 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360720 3:167735218-167735240 GACAGAGCAGAGGAAGGAAGGGG 0: 1
1: 1
2: 12
3: 170
4: 1467
965360715_965360726 13 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360726 3:167735236-167735258 AGGGGGTGAGGGGCCTGTGGTGG 0: 1
1: 0
2: 7
3: 150
4: 1357
965360715_965360718 -7 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360718 3:167735216-167735238 CTGACAGAGCAGAGGAAGGAAGG 0: 1
1: 2
2: 7
3: 74
4: 653
965360715_965360728 15 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360728 3:167735238-167735260 GGGGTGAGGGGCCTGTGGTGGGG 0: 1
1: 0
2: 14
3: 111
4: 962
965360715_965360719 -6 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360719 3:167735217-167735239 TGACAGAGCAGAGGAAGGAAGGG 0: 1
1: 1
2: 12
3: 114
4: 954
965360715_965360725 10 Left 965360715 3:167735200-167735222 CCATTGAGGGGGCGGGCTGACAG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 965360725 3:167735233-167735255 GGAAGGGGGTGAGGGGCCTGTGG 0: 1
1: 1
2: 10
3: 129
4: 1316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965360715 Original CRISPR CTGTCAGCCCGCCCCCTCAA TGG (reversed) Intergenic
901570098 1:10153141-10153163 TTGGCAGCCCGCCCTCTCTAGGG - Intronic
902456128 1:16535210-16535232 CTGTCAGCCGGCCTGCTCCAAGG - Intergenic
902496038 1:16872701-16872723 CTGTCAGCCGGCCTGCTCCAAGG + Intronic
902920866 1:19665374-19665396 CTTGCCGCCCGCCCCCTCCAGGG + Exonic
904322233 1:29705405-29705427 CTGGCAGCCCTTCCCCTCTAAGG - Intergenic
911208499 1:95117079-95117101 GTGTGAGCCCGCCCCCGCAGCGG - Intergenic
913453211 1:119006938-119006960 CTGCCCGCCCGCCCCGACAAAGG - Intergenic
913661476 1:121009475-121009497 CTGTCAGCCGGCCTGCTCCAAGG - Intergenic
913996149 1:143653192-143653214 CTGTCAGCCAGCCTGCTCCAAGG - Intergenic
914012842 1:143792655-143792677 CTGTCAGCCGGCCTGCTCCAAGG - Intergenic
914164987 1:145168530-145168552 CTGTCAGCCGGCCTGCTCCAAGG + Intergenic
914651467 1:149701264-149701286 CTGTCAGCCGGCCTGCTCCAAGG - Intergenic
917840916 1:178976772-178976794 ATGTCAGCCCTCCCCCACCAGGG + Intergenic
918300403 1:183198770-183198792 CTTTCTGCCTGCCACCTCAACGG - Intronic
919896030 1:202010359-202010381 CTGTCATCCCGCACCCTCTGGGG - Exonic
920049211 1:203153166-203153188 CTGCCAGCTCCCCCACTCAAAGG - Intronic
921891058 1:220353795-220353817 CTGTCTGCCTGCTCCCTCTAGGG + Intergenic
1068404906 10:56575490-56575512 CTGTCACCCAACTCCCTCAAGGG - Intergenic
1069757707 10:70783183-70783205 CGGTCAGCCAGACCCCCCAATGG - Intronic
1070284708 10:75074404-75074426 CTGTCAACCTTCCTCCTCAATGG + Intergenic
1073814016 10:107185741-107185763 CTCTCAGCCTCCACCCTCAAGGG - Intergenic
1076783868 10:132739395-132739417 CTGTCGGCACGCCCCCACCACGG - Intronic
1083684955 11:64370328-64370350 CTGCCAGGCCTCCCCGTCAAGGG - Exonic
1083922265 11:65787291-65787313 CGTTCAGCCCGGCCCCGCAAAGG + Exonic
1084838667 11:71827222-71827244 GTGGCAGCCCCTCCCCTCAAAGG + Intergenic
1088681884 11:112250563-112250585 CTGTCAGCCCACCCACACACAGG + Intronic
1089181104 11:116583425-116583447 CTGTCAACCAGGCCCCTCACTGG + Intergenic
1089455107 11:118621445-118621467 AGGTCGGCCCGCCCCCTCAAAGG + Intronic
1092400012 12:8166867-8166889 GTGGCAGCCCCTCCCCTCAAAGG - Intronic
1092954565 12:13537827-13537849 CTATCTGCCCTCCCCATCAAAGG - Exonic
1094759576 12:33515412-33515434 CTCTCATTCTGCCCCCTCAAAGG + Intergenic
1102170072 12:110835643-110835665 CTGTCTGGCCTCCTCCTCAAGGG - Intergenic
1102349819 12:112184203-112184225 CTCGCCGCCCGCCCCATCAAAGG - Exonic
1102475740 12:113186983-113187005 CTGTGAGACCACCCCCTCAAGGG + Exonic
1103345538 12:120247332-120247354 CTGCCAGCTGGCTCCCTCAAAGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1110522073 13:76491503-76491525 CAGTCAGGCAGCACCCTCAAAGG + Intergenic
1118870055 14:69733998-69734020 CTGTCAGACCAACTCCTCAAAGG - Intronic
1202848581 14_GL000225v1_random:1588-1610 ATGTCAGTCCGCCCCCCCAGAGG + Intergenic
1124134257 15:27020185-27020207 CAGTCAGGCCGCACCCTCCATGG + Intronic
1124247152 15:28080597-28080619 CTGTCATCCTGCCCGCTCCAGGG - Intronic
1124621609 15:31277236-31277258 CTGTCAGCCCTGACCCTCAGAGG + Intergenic
1127224435 15:56915591-56915613 ATGTCAGTCCGAACCCTCAAGGG + Intronic
1129814645 15:78540758-78540780 CCCTCAGCCCGCCCCCTCGCGGG - Intronic
1131983683 15:98019908-98019930 CTGTCAGCCATCCACCTCCATGG + Intergenic
1133292057 16:4728797-4728819 CAGTCAGTACGGCCCCTCAAAGG - Intronic
1139638612 16:68274806-68274828 ATGTCAGCTCGCCACCTCAAAGG + Exonic
1142976163 17:3645928-3645950 CTGTCACTCAGACCCCTCAAAGG - Intronic
1143096492 17:4481090-4481112 CTGTCAGCTCAGCTCCTCAAGGG - Intronic
1145014518 17:19387601-19387623 CCCTCAGCCCTCCCCCTCAATGG - Intergenic
1146310559 17:31765191-31765213 CTGTCACCCAACCCACTCAAGGG + Intergenic
1147757916 17:42780637-42780659 CTGTCAGGCCGCCTCCTCTCCGG + Intergenic
1150764484 17:67992847-67992869 CTGTCAGCCCCCACCCTCAAGGG - Intronic
1151798846 17:76365380-76365402 CTCCCAGCCAGCCCCCTCAGTGG - Intronic
1152646782 17:81472839-81472861 CTGGCAGCCCGCCTTCACAACGG + Intergenic
1152789709 17:82272758-82272780 CTGTCTGGCTGCCCCCTCAGAGG - Intronic
1153773805 18:8435597-8435619 CTGTCTGCATGCCCCCTCTAGGG + Intergenic
1159718839 18:71859394-71859416 CTGTCAGCCCCTCCCATCACAGG - Intergenic
1162548699 19:11346380-11346402 CTGGGATCCCGCCCCCTCCACGG + Intronic
1167748406 19:51366349-51366371 GGGTCAGCCCGCACCCTCAGCGG + Intronic
929791063 2:45023477-45023499 CTGTCAGCCTGCCCCCACCATGG - Intergenic
931882764 2:66583426-66583448 CTGGGAGGCCGCCCCCTTAAAGG - Intergenic
932254548 2:70273084-70273106 CTGCCACCCCGCCCCCTCCCAGG + Intronic
934754611 2:96816516-96816538 CCGGCAGCCCGCCCCCTCCGGGG - Exonic
938405868 2:131032779-131032801 CTGTCTGTCCAACCCCTCAAGGG + Intronic
1169344760 20:4821472-4821494 CTCTCAGCCAGGCTCCTCAAAGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170485934 20:16816398-16816420 CTGTCTGCCTGCTCCCTCTAGGG - Intergenic
1176099412 20:63358192-63358214 CAGTCAGCCAGCCCCGTCCAGGG - Intronic
1182278566 22:29205694-29205716 CTGGCACCCCGCCCCCAAAAGGG + Intergenic
951722226 3:25712426-25712448 CAGTCAGCCCTCCCACCCAAGGG + Intergenic
954580819 3:51702121-51702143 CTGTCTGCCCACCCACCCAATGG - Intronic
955016151 3:55071899-55071921 CTGTTAACCTGCCGCCTCAAAGG + Intronic
958883203 3:99696559-99696581 CTGTCTGCCTGTCCCCTCAGAGG - Intronic
960063723 3:113349238-113349260 CTGTCAGCCGACTCCCTCGAGGG + Intronic
962797679 3:138863191-138863213 CTGTCAGCAAGCCCTCTCACAGG - Intergenic
965360715 3:167735200-167735222 CTGTCAGCCCGCCCCCTCAATGG - Intergenic
968950775 4:3690309-3690331 CTGTCAGCCTGCGTCCTCGAGGG + Intergenic
969167497 4:5329598-5329620 CTGTCAGCCCAGCCCCTCCCAGG + Intronic
974587293 4:63896070-63896092 CTGTCAGCCAGACCCCAGAATGG - Intergenic
975416954 4:74115549-74115571 CTGACAGAGCACCCCCTCAAGGG - Intronic
988984420 5:36602928-36602950 GTGTCAGCCGACCCCTTCAAGGG + Intergenic
994318385 5:98360751-98360773 CTGTCTGCCGGCCCCTTCCAGGG - Intergenic
1000210674 5:159104187-159104209 CTGTGGGCCCGCCCTCACAAGGG - Intergenic
1001631348 5:173177819-173177841 CTGGCTCCCCGCCCCCTCCAGGG - Intergenic
1007780979 6:44254620-44254642 CTTTCAGCCAGCTCCCTCAGAGG + Exonic
1016997116 6:149968495-149968517 CTGCCAGCCCAGCCCCTCAGAGG + Intronic
1016998421 6:149977359-149977381 CTGCCAGCCCAGCCCCTCAAAGG + Intergenic
1017001683 6:150001758-150001780 CTGCCAGCCCAGCCCCTCAGAGG - Intergenic
1018650498 6:165988261-165988283 CTGCCAGCCCGCCCCCCCGGGGG + Intergenic
1026275546 7:68872634-68872656 CTGCCACCCCGCCACCTCCATGG + Intergenic
1026598558 7:71754310-71754332 TTTTCAGACAGCCCCCTCAAAGG + Intergenic
1036294443 8:7524297-7524319 CTGTCAGCCCTCCACATCCATGG + Intergenic
1036328119 8:7796694-7796716 CTGTCAGCCCTCCACATCCATGG - Intergenic
1037750499 8:21679070-21679092 CTGTCTGCCTTCCACCTCAAGGG + Intergenic
1039014542 8:33131282-33131304 CTGTCAGCTCTCCACCTCCATGG - Intergenic
1039276018 8:35934730-35934752 CTGTCACCCCACTCACTCAAGGG + Intergenic
1040971445 8:53140853-53140875 CTGTCACCCGGCTCCATCAAGGG - Intergenic
1042919621 8:73908740-73908762 CTGTCACCCGACTCCCTCAAGGG + Intergenic
1049740936 8:144240521-144240543 CTGGGAGCCCGACCCCTCACAGG - Intronic
1051382209 9:16470492-16470514 CTGTCAGCCCCTCCCATCACAGG + Intronic
1053432786 9:38054251-38054273 TTGTCAGCTAGCCCCCACAAGGG + Intronic
1055383114 9:75730637-75730659 CTGTTTCCTCGCCCCCTCAATGG - Intergenic
1057190599 9:93084888-93084910 ATGTCAGCTCGGCCCCTCAAGGG - Exonic
1060661907 9:125409372-125409394 CAGGCAGCTCGCCCCCTCCAGGG - Intergenic
1061304301 9:129723517-129723539 CTGCCACCCCGCCACCCCAAGGG - Intergenic
1061790076 9:133054610-133054632 CTGCCAGCCCACCCCCTCCTAGG - Intronic
1062116947 9:134814656-134814678 CTGGCAGCCAGCCCCCTGCAGGG + Intronic
1195552379 X:106184290-106184312 CTGTCACCCAACTCCCTCAAGGG - Intronic
1195878717 X:109570551-109570573 CTCACAGCCCCACCCCTCAAGGG - Intergenic
1196038398 X:111173224-111173246 TTGTCAGCACTCCCCCTGAAAGG - Intronic
1198807051 X:140503583-140503605 CTTTCAGCCCTCCCCATCATCGG + Exonic
1200237082 X:154472866-154472888 CTGTCACCCCTCCCCCTGCAGGG - Exonic
1200945326 Y:8830051-8830073 CTGTCACCCAACTCCCTCAAGGG + Intergenic
1202192603 Y:22260178-22260200 CTGTCACCCATCTCCCTCAAGGG - Intergenic