ID: 965361134

View in Genome Browser
Species Human (GRCh38)
Location 3:167739622-167739644
Sequence TCCAGGGCCTTGAGGTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965361134 Original CRISPR TCCAGGGCCTTGAGGTTAAA TGG (reversed) Intronic
900383943 1:2400776-2400798 TCCAAAGCCTTGAGGGGAAAAGG + Intronic
900389733 1:2428750-2428772 TCCAGGGCCCTGAGGCTGAGGGG + Intronic
900627359 1:3614940-3614962 TGCAGGGCAAGGAGGTTAAACGG - Intergenic
904620256 1:31770888-31770910 TCCCGAGCCTTGTGGTTAGAGGG + Intergenic
910656667 1:89626685-89626707 TCCAGGGTCTTGAGTATAGAAGG + Intergenic
910731796 1:90405947-90405969 TGAAGGGCCCTGAGGGTAAATGG + Intergenic
915650451 1:157306736-157306758 ACCAGAGCCCTGAGTTTAAAAGG + Intergenic
918301359 1:183207126-183207148 TGATGGGCCTTCAGGTTAAAAGG - Intronic
922953259 1:229577180-229577202 TCCAGGGCATTAATGTTAATGGG + Intergenic
923538298 1:234869924-234869946 GCCAGGCCCGTGAGTTTAAAAGG - Intergenic
923559514 1:235028021-235028043 GCCACGGCCTTGAGGTTGCAGGG - Intergenic
923591685 1:235326381-235326403 TCCAGTGACTTGGGGTTATATGG - Intronic
1067655491 10:48188505-48188527 TCCAAGGCACTGAGGGTAAAGGG + Intronic
1070501830 10:77079810-77079832 TCTAGGGCCTAGAGGTTATAGGG - Intronic
1070526195 10:77298014-77298036 TCAAGGGCCTTGAAGTTGACTGG - Intronic
1070731588 10:78832156-78832178 TCAAAGGCCTGGAGGCTAAAGGG + Intergenic
1071027789 10:81136903-81136925 TCCAGGGGCATGATTTTAAAGGG + Intergenic
1071764051 10:88641792-88641814 TCTAGGGCCCTGAGGCTAAGTGG + Intergenic
1073165433 10:101444943-101444965 GGCATGGCCTTGAGGTTATAGGG + Intronic
1078183937 11:9035389-9035411 TCAAGAGCTTTGAGTTTAAAAGG + Intronic
1079277769 11:19057650-19057672 TGCAGGGCTTTGAGGGGAAAAGG + Intronic
1080920717 11:36706833-36706855 TCCAGGGCCCTGATGTTTACAGG - Intergenic
1083727758 11:64637275-64637297 TCCAGGGCCCTCAGGTAGAAAGG - Intronic
1084344156 11:68533103-68533125 GCCAGAGCCCTGAGGTAAAATGG - Intronic
1087012826 11:93529687-93529709 TCCTTGGCCTTGGAGTTAAAGGG - Intronic
1090988283 11:131793024-131793046 TCCAGGGCCTTCACTTTAATGGG - Intronic
1091315046 11:134608703-134608725 TCCGGGGCCCTGAGGTGAGAAGG - Intergenic
1094013524 12:25835420-25835442 GCTAGAGCCTTGGGGTTAAATGG - Intergenic
1095650413 12:44601300-44601322 TCCAAGTCCTTCAGGTTAATTGG - Intronic
1096844857 12:54400847-54400869 TCCAGGCCCTTTGGGTTAATGGG + Exonic
1102748026 12:115267307-115267329 GCAAAGGCCTTGAGGCTAAAGGG + Intergenic
1104692051 12:130833765-130833787 TTCAAGGCCTTTTGGTTAAAAGG - Intronic
1108012836 13:46038047-46038069 TCCAGGGTCTGGAGGTAAACTGG + Intronic
1110322230 13:74173529-74173551 TCCACTGCCTTGAGGTGGAAAGG - Intergenic
1112107485 13:96257170-96257192 ACCAGGACCTTGAGATTAATGGG + Intronic
1118412242 14:65493171-65493193 TCCAGGGCATAGAGGATTAAAGG + Intronic
1119212829 14:72845644-72845666 TCCAAGACCTGGAGGATAAAAGG + Intronic
1120192202 14:81449825-81449847 TCCAGGGCCTTTAGTTGCAAGGG + Intergenic
1123910259 15:24958793-24958815 TCCAGGAGTTTGAGGTTACAGGG - Intronic
1126274056 15:46855586-46855608 TGCATGGGCTTGAGTTTAAAAGG + Intergenic
1128407652 15:67359446-67359468 TCCTGGGCATGGAAGTTAAAAGG + Intronic
1135847737 16:25934055-25934077 TCAAGGGCCTCAAGGTTGAAAGG - Intronic
1136135974 16:28257147-28257169 TCCAGGGCTTTGAGGAGGAAGGG - Intergenic
1139081063 16:63522050-63522072 TCTAGGGTCTCGGGGTTAAAAGG - Intergenic
1140138605 16:72231416-72231438 TCCACTGCCTGAAGGTTAAAGGG + Intergenic
1141235966 16:82216844-82216866 CCCAGAGCTTTGTGGTTAAAAGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142992808 17:3743039-3743061 GCCAGGGCCTTCAGGCTGAATGG - Intronic
1143518660 17:7432930-7432952 TCTAGGGCCTTGAGGATAATGGG - Intergenic
1147539020 17:41341265-41341287 TCCACAGCCTTGAGAATAAAAGG - Intergenic
1151179984 17:72320347-72320369 TCCAGGGCATTGCGGCTCAACGG + Intergenic
1151890325 17:76947587-76947609 CCCAGGGCCTTGGGGTTGGATGG - Intronic
1152630680 17:81409497-81409519 GCCAGGGCCACGAGGTGAAAAGG - Intronic
1153364657 18:4242100-4242122 TCGAGGGCTTTGAGGATGAAGGG - Intronic
1155928225 18:31680248-31680270 GCCAGGGCCAGGAGGCTAAAGGG + Intronic
1156119536 18:33825309-33825331 TCTAGGCCCTTGAGGTGACATGG - Intergenic
1156303318 18:35854257-35854279 ACCTGGCCCTTGAGGCTAAATGG + Intergenic
1156767595 18:40677020-40677042 TCCAGGTTGTTGAGGTTGAAGGG - Intergenic
1158664872 18:59423421-59423443 TCCAGAGCCCTGGGGTAAAAAGG + Intergenic
1166571531 19:43799765-43799787 TTCATGGCCCTGAGGTCAAAGGG + Exonic
1167845190 19:52157377-52157399 TACAGGACCTTGAGTTTCAATGG - Exonic
927013293 2:18928896-18928918 TCTAGGGCTTTCAGGTTCAAGGG + Intergenic
928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG + Exonic
929389513 2:41453462-41453484 ACCAGGGCCTGAAGGTTATAAGG + Intergenic
929644620 2:43614215-43614237 TCAAGAGCCTTGAGGTTTGAGGG + Intergenic
930187647 2:48426354-48426376 TCCAGGGCCTAGACTTTAAGTGG + Intergenic
932105318 2:68936495-68936517 TCCAGGGCTTTGAGGGTTACAGG - Intergenic
935372038 2:102357072-102357094 TCCAAGGCCCTGAGGTTGAGAGG - Intronic
935387830 2:102519854-102519876 TCCAGGGCCCAGAGGATACAAGG + Exonic
939400405 2:141685012-141685034 TCCAAGGTCTTGAGGCTTAATGG + Intronic
940987625 2:160064141-160064163 TCCAGGGCAGTGAGAGTAAAGGG + Intergenic
940992307 2:160110456-160110478 TCCAGGCCCTTGAGGTGATGAGG - Intronic
942060001 2:172220199-172220221 TCAAGGGCCTTTAAGATAAATGG + Intergenic
942714481 2:178875487-178875509 CCCAGGAGCTGGAGGTTAAAGGG + Intronic
943715211 2:191144164-191144186 ACAAGGTCCTTGAGGGTAAAAGG - Intronic
945486216 2:210399139-210399161 TCCATGGCTTTGAATTTAAAAGG - Intergenic
947407293 2:229792087-229792109 TTCAGGGCCTTTGGCTTAAATGG - Intronic
947796797 2:232898259-232898281 TTCAGGGCCATGTGGTTTAATGG - Intronic
1169833715 20:9854100-9854122 TCCATGGCCTTAAAGTTACATGG - Intergenic
1170375204 20:15692575-15692597 TCCAGGGCTCTGAAGATAAAGGG - Intronic
1170569654 20:17625588-17625610 TCCAGCTCCTTGAGGCTGAAGGG + Exonic
1177829162 21:26117548-26117570 TCCAAGGCCATGGGGTTATAGGG + Intronic
1180684358 22:17653575-17653597 CCCAGGAGCTTGAGGTTACAAGG - Intronic
1181313017 22:21955732-21955754 TCCAGGACCCTTAGGTTATAGGG - Intergenic
1181346124 22:22221804-22221826 TCCAGGACCCTTAGGTTATAGGG - Intergenic
1182374268 22:29835043-29835065 TGTGGGGCCTAGAGGTTAAAGGG - Intronic
1184590130 22:45476487-45476509 TCCCAGGCCTCGGGGTTAAATGG + Intergenic
950439992 3:13004897-13004919 TCCAGCTCCTGGAGGTTACACGG + Intronic
950524863 3:13517700-13517722 TCCTGGGCCTTGAGTTGGAAGGG - Intergenic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
954807078 3:53226830-53226852 TCCAGGGGCTTGATGGTGAAGGG + Exonic
955465513 3:59232978-59233000 TAAAGGGGCTTGAGGTTGAAAGG + Intergenic
955646051 3:61138456-61138478 CTCAGGGCCATGAGGTGAAAAGG - Intronic
959694456 3:109234414-109234436 ACCAGGGCCTTGAGTCTCAATGG + Intergenic
961078039 3:123999967-123999989 ACCAGAGTCCTGAGGTTAAACGG - Intergenic
961453290 3:127012204-127012226 CCCAGGGCCGTGAGGATAACCGG - Intronic
965361134 3:167739622-167739644 TCCAGGGCCTTGAGGTTAAATGG - Intronic
967500243 3:190188953-190188975 GACAGGGCCTTGGGGTTCAATGG - Intergenic
967764755 3:193266887-193266909 TCAAGGGCCCTAAGCTTAAAGGG - Intronic
967814866 3:193789996-193790018 TCCTGGGACTTGTGGTTAATTGG + Intergenic
972297941 4:37757964-37757986 TATAGTGCCTTGATGTTAAACGG + Intergenic
983217701 4:165017355-165017377 TTCAGAGTCTTGAAGTTAAAGGG + Intergenic
985045769 4:185939075-185939097 GCCAGGGCGCAGAGGTTAAAGGG - Intronic
985493538 5:192515-192537 TCCAAGGCCATGAGGCTACACGG + Intronic
985641652 5:1066117-1066139 TCCAGGGCCTGAAGGTCAGAGGG - Intronic
987167007 5:15209611-15209633 ATCAGGGGCTTGAGGTTACAGGG - Intergenic
988451427 5:31347410-31347432 CCCAGGGCATGGAGGTTAAGAGG + Intergenic
998638790 5:143986392-143986414 TCTAGGGCCCTGAGCTTAGAAGG - Intergenic
1000744172 5:165010667-165010689 TCCAAGCCCTTAAGGCTAAATGG + Intergenic
1003583084 6:7360193-7360215 TCAAGGGCCTTGAGATTCAGGGG - Intronic
1006573483 6:35025328-35025350 TCCATGGCCTTGATGCTAACAGG + Intronic
1007127764 6:39441770-39441792 CCCAAGGCTTTGAGGTTAAAGGG + Intronic
1010649275 6:78432302-78432324 TCCAGGGTCTTTAGGTTAGGTGG + Intergenic
1011594252 6:89001264-89001286 CCCAGGGGTTTGAGGTTACAGGG - Intergenic
1012845328 6:104381179-104381201 CCCTGGGTCTTGAGGGTAAAGGG - Intergenic
1013296173 6:108760240-108760262 TCTTGGGCCTGGAGGGTAAAGGG + Intergenic
1015172613 6:130270521-130270543 TCCTGGGACTTTAGGTAAAAGGG + Intronic
1019493730 7:1326635-1326657 TCCAGGGCCCTGTGGTTGGAAGG - Intergenic
1023104405 7:36749422-36749444 TCCAGGGGCTTGGGGGCAAAGGG + Intergenic
1027307848 7:76920681-76920703 TCCAAGCCCTTGTTGTTAAAGGG + Intergenic
1027672729 7:81121560-81121582 TTCAGGACCTTGAAGATAAAGGG - Intergenic
1032120138 7:129149625-129149647 TCCGGGGCTTTGAGTTTGAATGG + Intronic
1032748476 7:134812057-134812079 TTAAGGGACTTAAGGTTAAAAGG + Intronic
1033071623 7:138208569-138208591 CCCAGGGCCTTGTTGTTTAAGGG - Intergenic
1033107242 7:138538442-138538464 TCCAGGGCCTTGAGGAGTGAGGG + Intronic
1036125211 8:6056166-6056188 TTCAGGGCCTTGAGGTGAATGGG - Intergenic
1036181640 8:6590849-6590871 ACCAGGGCCTTGAGGTCCAAAGG - Intronic
1036515260 8:9437849-9437871 TATAGAGCCTTGAGGTTAAGTGG - Intergenic
1037727404 8:21494434-21494456 TCAAGGGCCCTGAGGAAAAAGGG - Intergenic
1038330579 8:26605101-26605123 GCCAGGGACCTGATGTTAAATGG - Intronic
1039503242 8:38032960-38032982 TCCAGGTGCTTGAGGATAACTGG + Intronic
1040008001 8:42636984-42637006 TCCAAGGCCCTGAGTTTGAATGG - Intergenic
1040602006 8:48894598-48894620 TCCAGAGCCTAGAGCTTAATGGG - Intergenic
1042318044 8:67444937-67444959 TCCAGGGACTTGATGTTTCAAGG + Intronic
1043773390 8:84233606-84233628 TCCAGGGTTTTGAGTTTGAACGG - Intronic
1045245420 8:100437964-100437986 TCCAGTGCCTGGAGGATAAATGG + Intergenic
1046621436 8:116532724-116532746 TCCTGGGCCTTGGCGTTCAACGG - Intergenic
1046706827 8:117463432-117463454 TCCAGGGCCTTGGGGGTATTAGG - Intergenic
1049467003 8:142756106-142756128 TCCGGGTCCTTGAGGTTGCAGGG + Intergenic
1051089886 9:13393945-13393967 TCTAGGGCCTAGAGCTTCAAAGG + Intergenic
1051503838 9:17806469-17806491 TGTGGGGCTTTGAGGTTAAAGGG + Intergenic
1052392656 9:27898938-27898960 TACAGGTCCTTGGGGTTAAGAGG + Intergenic
1059719453 9:116945418-116945440 TTCATAGCCTTTAGGTTAAAAGG - Intronic
1061263089 9:129490681-129490703 TGCAGGGCCCTGAGCTGAAATGG - Intergenic
1062347060 9:136119642-136119664 TCCAGTGCCTTGAATTTGAAGGG - Intergenic
1062721816 9:138048485-138048507 TCCATGGCATTGAGGTCCAAAGG + Intronic
1187971843 X:24666829-24666851 TCCAAGTCCTTGAGAATAAAGGG + Intronic
1188212418 X:27441778-27441800 TCCTGGGACTTGGGGATAAAAGG - Intergenic
1189423144 X:40874617-40874639 TTCACGGACTTAAGGTTAAAAGG + Intergenic
1194358032 X:92912408-92912430 GCCAGGGCCTGGAGATTAAGGGG + Intergenic
1194885096 X:99304948-99304970 TCCACTGCTTTGAGTTTAAACGG + Intergenic
1195849062 X:109263817-109263839 ACCAGGGCCTTGAGATGACATGG - Intergenic
1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG + Intronic
1199852603 X:151736356-151736378 TCCAGGGCCTTGGGGTTGGAGGG + Intergenic
1200666213 Y:6028059-6028081 GCCAGGGCCTGGAGATTAAGGGG + Intergenic
1201361877 Y:13160893-13160915 TCCAGGTCCTGGAGGAAAAAAGG - Intergenic