ID: 965362416

View in Genome Browser
Species Human (GRCh38)
Location 3:167757594-167757616
Sequence CTGTATATTCAAATGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965362416 Original CRISPR CTGTATATTCAAATGAACCA GGG Intronic
900307536 1:2018677-2018699 CTTTATGTTCAAAAGATCCAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
910533154 1:88264395-88264417 CTTTATATTCTGAGGAACCAAGG + Intergenic
910735774 1:90455315-90455337 GTGGATACTCAAATGCACCAGGG - Intergenic
911587314 1:99705479-99705501 CTGTATATTCTCATGAGGCAGGG - Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
913365871 1:118037941-118037963 TGGGAAATTCAAATGAACCATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
916627824 1:166578170-166578192 CTTTATAATCAAATAAACCTGGG + Intergenic
916737716 1:167622802-167622824 CTGTAAATTAGAATGACCCAGGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918456576 1:184725492-184725514 CTGTATGTTCAAATGTCTCAAGG - Intronic
919456506 1:197826787-197826809 CTATATATTAAAATGAAATAGGG + Intergenic
1064633505 10:17341163-17341185 TTGTATATTTAAAGGAATCATGG + Intronic
1064678372 10:17784544-17784566 CTGTACATTAAAATCAACTATGG + Intronic
1065965966 10:30770359-30770381 CTGTTTATTCAAAAGAGACAGGG + Intergenic
1068536022 10:58242593-58242615 CACTATACTCAAATCAACCAAGG + Intronic
1068799447 10:61123048-61123070 ATCTATATTAATATGAACCATGG - Intergenic
1069190623 10:65483709-65483731 GTGTATAATCAAATAAAGCAGGG - Intergenic
1071125626 10:82331735-82331757 CTGTTTATTAAAGTGGACCATGG + Intronic
1074224281 10:111468347-111468369 CTGTATATTAAAATCATCTATGG - Intergenic
1075775452 10:124982603-124982625 CTCTAAGTTCAAATGAACCATGG - Intronic
1078808137 11:14727320-14727342 CTTAATATTCAAAACAACCATGG + Intronic
1079711082 11:23682528-23682550 CTGTATATTGAGATGATACATGG + Intergenic
1085925276 11:81011248-81011270 TTGGATATTCTAATGAACCTAGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1088160122 11:106859020-106859042 CTGTAAATTAAAATTAACCCTGG + Intronic
1092631740 12:10386851-10386873 CAGTATATTGAAATGAATCTTGG - Intronic
1092692116 12:11124933-11124955 CAGGATAATCAATTGAACCAGGG - Intronic
1092917971 12:13205333-13205355 TTGTATATTCAAATGCACTCAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097371613 12:58788520-58788542 CGGTATATTCATATGTACCATGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099706473 12:86159638-86159660 CTGTAAATTCACCTGAACCAGGG + Intronic
1104061954 12:125276148-125276170 CTATATATTTAAATAAACAAAGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1107993053 13:45835129-45835151 GAGTATATTCAAATAAATCAGGG - Intronic
1109688936 13:65860591-65860613 CTGTGTATTCAAAGGCAGCAGGG + Intergenic
1109705973 13:66092952-66092974 CTGTTTATCCAACTGAAGCAGGG - Intergenic
1110324031 13:74193474-74193496 CTGTAGAGTCAAATAAACCTGGG - Intergenic
1110689455 13:78415295-78415317 CTGTGTTTTCAAAAGAAACATGG + Intergenic
1110843494 13:80168889-80168911 CTGTATCTTCTAAGTAACCAAGG + Intergenic
1111782546 13:92746796-92746818 CTGTATATGTTAATGAATCAAGG - Intronic
1113327952 13:109301092-109301114 CTGCACATTCAAATCATCCAGGG - Intergenic
1115794672 14:36921303-36921325 CTGTATGAACAAATGAACTATGG - Intronic
1117980335 14:61336689-61336711 TTGGATATTCAAACTAACCAAGG - Intronic
1118890838 14:69907512-69907534 CTTTATCTTGTAATGAACCAAGG + Intronic
1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG + Intergenic
1127951321 15:63809256-63809278 TAGTATATTCTAATGAACCAAGG + Intronic
1128722992 15:69965884-69965906 CTGTATTTTCAATAGAAACAGGG + Intergenic
1130372823 15:83300990-83301012 CTCCATGTTCAAATGAATCATGG - Intergenic
1131746886 15:95458345-95458367 CTGTATATTGAAACAAATCAGGG - Intergenic
1132089619 15:98937185-98937207 TTGTGTATTAAAGTGAACCAAGG - Intronic
1134505257 16:14800537-14800559 CTGTATCTTCAAAAGTATCAAGG - Intronic
1134575319 16:15328373-15328395 CTGTATCTTCAAAAGTATCAAGG + Intergenic
1134727126 16:16428119-16428141 CTGTATCTTCAAAAGTATCAAGG - Intergenic
1134940311 16:18283736-18283758 CTGTATCTTCAAAAGTATCAAGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1138938856 16:61764696-61764718 CTGTACATTAAAATGAACATTGG - Intronic
1140527806 16:75638031-75638053 CTGAATGTTCAAAGGAAGCACGG - Intronic
1141222528 16:82084417-82084439 CTGCAGATTTAAATGAACCATGG + Intronic
1141284051 16:82654699-82654721 CTGTACCATCAAAGGAACCATGG + Intronic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1143463566 17:7120250-7120272 TTGTAGACTCAAATGATCCATGG + Intergenic
1147692529 17:42325379-42325401 CTGTATCTTCACATGAAACAGGG + Intronic
1149209286 17:54285820-54285842 TTGTATATTGAAATGACCAAGGG + Intergenic
1149227801 17:54495824-54495846 CTGTATATTCCATTCAAACAAGG + Intergenic
1154311395 18:13269531-13269553 GTGTCTTTTCAAATGAACCGGGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155844271 18:30685782-30685804 TTGTTGATTCAAATGACCCATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158742565 18:60160280-60160302 TTGTACATTATAATGAACCAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158907908 18:62031659-62031681 ATGAATATTCAAAAGAAACAGGG + Intergenic
1159560680 18:69989924-69989946 CTGAATATTCAAAGCAACCTTGG + Intergenic
1159715975 18:71823752-71823774 CTGTGTCTTCAAATGGTCCAAGG - Intergenic
1159799860 18:72884802-72884824 CTGTTTATTTAAATGGACTATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1165030370 19:32993940-32993962 CTCTACATTCAAATGACCTAAGG - Intronic
1166264906 19:41674228-41674250 CTGTTTATTCAAATGCACGGTGG - Exonic
925893032 2:8451409-8451431 TTGTACTTTCAAAAGAACCATGG - Intergenic
927359004 2:22209707-22209729 CGCAGTATTCAAATGAACCATGG - Intergenic
930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG + Intronic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
931996036 2:67840094-67840116 CTTTAAATTCAAATGGACCTGGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936766907 2:115861969-115861991 CTGAATATTGAAAAGACCCAAGG - Intergenic
937389824 2:121475469-121475491 CTGTATCTGCAACTGGACCATGG + Intronic
938204449 2:129406412-129406434 ATTTATATTCAAAAGAAACACGG + Intergenic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939287291 2:140148763-140148785 ATGTAGATCCAAATGAAACATGG + Intergenic
939641922 2:144650337-144650359 AAGTCTATTAAAATGAACCAAGG + Intergenic
939728150 2:145749476-145749498 CTGTATGTTCAAACAAACAAAGG + Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941171163 2:162139135-162139157 CTGTATAGTCACATTACCCAAGG + Intergenic
941199947 2:162495983-162496005 CTGTAAATCAAAATGAATCAAGG - Intronic
941464567 2:165810889-165810911 TTTTACATTCAAATGAACTAGGG - Intergenic
942496203 2:176542223-176542245 ATGTGTATGCAAATGAACAAAGG - Intergenic
942909563 2:181226784-181226806 CTGTATATTCAAATAAACTTAGG + Intergenic
943293173 2:186101877-186101899 CTGTAAAATCAAATGAACTTTGG - Intergenic
943817536 2:192275627-192275649 CTGTATATTTAAATAAATCCTGG + Intergenic
944016488 2:195045471-195045493 CTGTATTTTCAAATGGTCCTTGG - Intergenic
944178861 2:196864295-196864317 CAGTAGAATCACATGAACCAGGG + Intronic
945718891 2:213393161-213393183 ATGCATTTTCAAATGATCCAGGG - Intronic
945787499 2:214260505-214260527 CAGTGTAGTCAGATGAACCAAGG - Intronic
945941274 2:215953318-215953340 CTGTATATTAGAATCACCCAGGG + Intronic
948051394 2:234982064-234982086 CCGGATATTCAAATGGACCCGGG - Intronic
948337039 2:237217567-237217589 ATGTATATTTAAATAATCCACGG - Intergenic
948404826 2:237709460-237709482 CTGTGTATTAAAATCAACCCTGG - Intronic
1168815308 20:732721-732743 CTGTATCTTCTAAGAAACCAGGG - Intergenic
1169484376 20:6014548-6014570 CTGTCTATTCACATTAAACAAGG - Intronic
1170486963 20:16827810-16827832 CTTTATTTTCAAAAGAACTATGG + Intergenic
1173194066 20:40899534-40899556 CTGAATATTCAAATGTTCCCTGG + Intergenic
1174224771 20:48988515-48988537 CAGTATATTAAAATGAATCGGGG + Exonic
1174950428 20:55036021-55036043 CTGTTTATTCCAGTGAGCCAGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1179168084 21:38950782-38950804 CTGTATATTTACATGCTCCAAGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
951114070 3:18839183-18839205 CTGACTATTCAAATAAACCAAGG + Intergenic
954542281 3:51401670-51401692 CTTTATATTCAAATTAAGAATGG + Intronic
954977288 3:54708320-54708342 CTGCATGTTCTAATGAAACATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
957495457 3:80986034-80986056 CTGTATATTACAATGAACAATGG - Intergenic
957514449 3:81232548-81232570 CTGTATAGCCACATGAACAAGGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
960551839 3:118984612-118984634 ATGTAAATTCAAATGAAAGAGGG + Intronic
964777761 3:160297000-160297022 CTGTATAATTAAATGATACAGGG - Intronic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
966390210 3:179444540-179444562 CTGTGTATTTAAATGGAACATGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
970292857 4:14595105-14595127 CTTTATATTAAAATGAAACAAGG - Intergenic
970495935 4:16626046-16626068 CTGCATATTTGATTGAACCATGG + Intronic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
971643365 4:29163998-29164020 CTATATCTTCAAATTAACAATGG - Intergenic
972926120 4:44009565-44009587 CTGTTTATTAAAATTAACAAAGG - Intergenic
972996583 4:44886364-44886386 CTGTTTATTCAAATGTATCAAGG - Intergenic
973264629 4:48198885-48198907 ATGTATATTCAAAGGTACCAAGG + Intronic
975248632 4:72150144-72150166 TTGTATATTCAAATAACACATGG - Intergenic
975339956 4:73227970-73227992 CTATATATTCAAACAAAACAAGG + Intronic
976199672 4:82565790-82565812 CTGTTTTTTCAAATGAATTAGGG - Intergenic
976568961 4:86586453-86586475 CTGCAAATTCAAATTAACGAAGG - Intronic
977002438 4:91520158-91520180 ATGTATATTAAAATAAACAAAGG - Intronic
977450207 4:97186293-97186315 CTGTAGAGTCACATGAACAATGG - Intronic
977469245 4:97421340-97421362 GTGAATATTGAAAAGAACCATGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978842533 4:113231444-113231466 CTGTATATTCAAGATAACCATGG + Intronic
979411219 4:120382532-120382554 CTATATATTCACATGGAGCACGG - Intergenic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
982713091 4:158778213-158778235 CTGCATATGCAAATTACCCAAGG - Intronic
983911250 4:173242071-173242093 CTGTATATTAAACTTAAGCAGGG - Intronic
984023166 4:174511013-174511035 CTGGATATTCACATAAACTATGG + Intronic
984840668 4:184064642-184064664 ATGAAGGTTCAAATGAACCAGGG + Intergenic
985161413 4:187048339-187048361 CTGTTTGTTCAAATCAACCTCGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986895081 5:12355895-12355917 TTGTCTATTCAAATAAAACAAGG + Intergenic
987867058 5:23556406-23556428 CTGTATATCTAAATGAACTTAGG - Intergenic
988286373 5:29223049-29223071 CTGTAATTTCAAATGTTCCAAGG - Intergenic
990645679 5:57841574-57841596 CTGTGTATTCAAATGTAATAAGG - Intergenic
992395674 5:76367525-76367547 ATATATATTTAAATGAACGAAGG + Intergenic
992695314 5:79280151-79280173 CTGTTTCTTTAAATGAATCATGG + Intronic
994631442 5:102293610-102293632 ATGTATATTTAAATATACCATGG + Intronic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
996058435 5:119006124-119006146 CTGTTTAATTAAAGGAACCAGGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
999465926 5:151804357-151804379 CTGTATATGCAAAGTAAGCAAGG - Exonic
1000452296 5:161404799-161404821 CTGCATCTTCACATAAACCAGGG + Intronic
1001111687 5:168901856-168901878 CTGTCTATTCAAATGTCACAGGG - Intronic
1001321528 5:170686428-170686450 TTGGATACCCAAATGAACCACGG - Intronic
1001610474 5:172997411-172997433 CTGTATATGCAAAGTAAGCAAGG + Intronic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005355365 6:24977966-24977988 GTTTATATTGAAATGAGCCAAGG + Intronic
1007474498 6:42109832-42109854 CTGTATCTTCCAACGAACGATGG - Intronic
1010885242 6:81229426-81229448 CTGTATATTCAATTTACCCATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1012641895 6:101628575-101628597 ATGTGTAATCAAATGATCCAAGG + Intronic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013714257 6:112938554-112938576 CTTTTTATTCTAATGAACAATGG - Intergenic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1015314915 6:131807525-131807547 ATGGAAATGCAAATGAACCATGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1018124196 6:160666048-160666070 ATGTATATTCAGATCATCCAAGG - Intergenic
1018328537 6:162701964-162701986 CTGTATCTTCTATTAAACCAAGG + Intronic
1020132670 7:5568221-5568243 CTGCATCTTCAAATCAACCCTGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG + Intergenic
1026508007 7:71003064-71003086 CTGTGCATTCAAATCACCCAGGG - Intergenic
1026682022 7:72474217-72474239 CTCTATATTTAAATAATCCAAGG + Intergenic
1027427720 7:78078589-78078611 CTGTGTACTCAAATGAACAGTGG + Intronic
1028299809 7:89183806-89183828 CTGTATATTCAAATGCCAGAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029863046 7:103596182-103596204 CTGTTTACTCAAAGAAACCATGG - Intronic
1030908611 7:115217639-115217661 CTGTATATTCACATGTATCAGGG + Intergenic
1031211009 7:118826104-118826126 CTGTACATTAAAATGATCCAAGG - Intergenic
1031656979 7:124368318-124368340 TTGTATCCTCAAATGAAGCAAGG + Intergenic
1033165283 7:139034865-139034887 CTGAAAATTCAAATGACCCTGGG - Intronic
1033871295 7:145756926-145756948 CAGTATATTCAAATTTATCATGG + Intergenic
1035918006 8:3645802-3645824 CTGTCTATTCAAATGACACTGGG + Intronic
1038112495 8:24514836-24514858 TTGAAGATTCAAGTGAACCAGGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040570254 8:48602279-48602301 CTGAATATTGAAATGAACCGTGG + Intergenic
1041067342 8:54094665-54094687 CTGTCTACTAAAAGGAACCAGGG + Intronic
1042079376 8:65034466-65034488 TTATATATTCAAATGAAATATGG + Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1043135193 8:76514296-76514318 CTTTATCTTCAAAGAAACCAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045923636 8:107562745-107562767 CTGTATATTCAGAATAACAAAGG - Intergenic
1047157463 8:122336372-122336394 TTGTATATTTAAGTAAACCATGG + Intergenic
1049838059 8:144752951-144752973 ATGTATATTCAATAGAACAAAGG + Intronic
1055125836 9:72717443-72717465 CTAAATATTGAAACGAACCATGG - Intronic
1058708634 9:107659166-107659188 ATATATATTCAAATGCACCAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060067843 9:120519277-120519299 CTGTATTTTCAAATGTTCTAAGG + Intronic
1203774130 EBV:63340-63362 CTGTTTATCCTAATGAATCACGG + Intergenic
1186131514 X:6471095-6471117 CTGTACATTAGAATGACCCAAGG - Intergenic
1186550809 X:10503262-10503284 CTGTATATAAAACTGAGCCAAGG + Intronic
1186644932 X:11496461-11496483 CTTTATATTCAAATAAATGAGGG + Intronic
1193021460 X:76797762-76797784 CTGGGTATTCAAATCAAACATGG - Intergenic
1194770302 X:97895081-97895103 CTGTATATTCAAATAACAGAGGG - Intergenic
1195522981 X:105851879-105851901 CTTTGCATTTAAATGAACCAGGG - Intronic
1197346454 X:125329182-125329204 CTGTTTTTTTAAATGAATCATGG - Intergenic
1198014016 X:132590211-132590233 CTGAATCTTCAAATTAACCCAGG - Intergenic
1199548320 X:149031614-149031636 CTGGATATTCCAATGCACGAAGG + Intergenic