ID: 965362603

View in Genome Browser
Species Human (GRCh38)
Location 3:167760060-167760082
Sequence TCAAAGGTATGATGAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965362603_965362606 16 Left 965362603 3:167760060-167760082 CCTGTTTCTCATCATACCTTTGA 0: 1
1: 0
2: 6
3: 50
4: 302
Right 965362606 3:167760099-167760121 GAAAATAGATATGACTTGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 269
965362603_965362607 17 Left 965362603 3:167760060-167760082 CCTGTTTCTCATCATACCTTTGA 0: 1
1: 0
2: 6
3: 50
4: 302
Right 965362607 3:167760100-167760122 AAAATAGATATGACTTGTTGGGG 0: 1
1: 0
2: 0
3: 19
4: 293
965362603_965362608 18 Left 965362603 3:167760060-167760082 CCTGTTTCTCATCATACCTTTGA 0: 1
1: 0
2: 6
3: 50
4: 302
Right 965362608 3:167760101-167760123 AAATAGATATGACTTGTTGGGGG 0: 1
1: 0
2: 2
3: 16
4: 227
965362603_965362605 15 Left 965362603 3:167760060-167760082 CCTGTTTCTCATCATACCTTTGA 0: 1
1: 0
2: 6
3: 50
4: 302
Right 965362605 3:167760098-167760120 TGAAAATAGATATGACTTGTTGG 0: 1
1: 1
2: 2
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965362603 Original CRISPR TCAAAGGTATGATGAGAAAC AGG (reversed) Intronic
901825332 1:11857759-11857781 TCAAACGTCTGATGACTAACAGG - Intronic
902802133 1:18837118-18837140 TAAAAGGCATCATGAGAAAGAGG + Intergenic
902860053 1:19238778-19238800 TCAAAGGTATGGTGTGGCACTGG - Exonic
904032223 1:27540428-27540450 TCCCAGGCATGATGAGACACTGG + Intronic
905500522 1:38432910-38432932 TCAAAGGTTTTAGGAGAAATCGG - Intergenic
906247284 1:44285213-44285235 TCAAAGCAATGCTGAGACACAGG + Intronic
906392596 1:45431845-45431867 TCTAAGGAATGGTGAGAAACTGG + Intronic
907594005 1:55703306-55703328 TAAAAGGCATGAAAAGAAACGGG - Intergenic
907673479 1:56497419-56497441 TCAAGGGTTTGATGAGCTACTGG + Intronic
908066450 1:60410681-60410703 GCTAAGGTATGATGAGTATCAGG - Intergenic
910416652 1:87007562-87007584 TAACAGGTATGAAGTGAAACAGG - Intronic
910671747 1:89780702-89780724 TCAAAAAGATCATGAGAAACAGG + Intronic
911483763 1:98479050-98479072 TCAAATGTCTGATGAAAAGCAGG + Intergenic
911818534 1:102386053-102386075 TCAGAGGTATAAGGAGGAACTGG + Intergenic
914920374 1:151842922-151842944 GCAAAAGTATGATGAGAAACAGG + Intergenic
917186061 1:172357223-172357245 GTAAAAGTATGATGAGAAACAGG + Intronic
917203530 1:172543693-172543715 GCAAAGGTTTAATTAGAAACAGG + Intronic
917468145 1:175302321-175302343 ATAAAGGTATGATGAGAATATGG + Intergenic
917785076 1:178446431-178446453 TAAAAAGGATGAAGAGAAACAGG + Intronic
918304760 1:183235750-183235772 TCCAAGGTATAATGAGCCACGGG - Intronic
918412034 1:184269635-184269657 TAAAATGTATGATCAAAAACTGG - Intergenic
918526587 1:185471437-185471459 TCAAAGGTAGTAAGAGGAACAGG - Intergenic
919345084 1:196365474-196365496 TTAAAGGTATTTTGAGAAAAAGG - Intronic
920217154 1:204369000-204369022 TAAAATGAATGATTAGAAACTGG - Intronic
921621501 1:217330603-217330625 GCAAAGAGATGATGTGAAACTGG - Intergenic
922346157 1:224698296-224698318 TCAAAGCAATGATGAGATTCTGG + Intronic
923827595 1:237517078-237517100 TGCAAGGCATGATGACAAACAGG - Intronic
924155185 1:241168173-241168195 TGCAAGGAATGATGAGAAAGAGG + Intronic
1065132034 10:22631785-22631807 GCAAAAGTATGCTGAGAAACAGG + Intronic
1066045616 10:31593020-31593042 TCAAGGGTATAATTAGGAACTGG + Intergenic
1066126774 10:32349458-32349480 ATAAAGGAATGATGAGAAAAAGG - Intronic
1066446997 10:35492357-35492379 TCAATGGAATGAAGAGAAACAGG - Intronic
1066700913 10:38127124-38127146 AAAAATGTAAGATGAGAAACTGG + Intergenic
1067212510 10:44271868-44271890 CCAGAGGTATGAGGAGGAACTGG + Intergenic
1067784961 10:49239037-49239059 ACAAATGTATGATGTGTAACAGG + Intergenic
1067815191 10:49469148-49469170 ATAAAAGTTTGATGAGAAACAGG + Intronic
1069131321 10:64707324-64707346 TTAAAAGTTTGACGAGAAACGGG - Intergenic
1070473185 10:76804034-76804056 ACAAAAGTGTGATGAGAAACAGG - Intergenic
1071381871 10:85074037-85074059 TCAAATGTCTGATAAGAATCAGG + Intergenic
1071901416 10:90124142-90124164 TCAAAGGCATGATGTTGAACTGG - Intergenic
1072012468 10:91314717-91314739 TCAAATCCATCATGAGAAACAGG - Intergenic
1074790583 10:116882749-116882771 TCAAAGCTATGATTTGAAACTGG + Intronic
1077983428 11:7326191-7326213 TCAAAGGTACAAGGAGGAACTGG - Intronic
1079411694 11:20193635-20193657 TTAAAACTTTGATGAGAAACAGG - Intergenic
1080262973 11:30369933-30369955 CAAAAAGTGTGATGAGAAACAGG - Intergenic
1080831917 11:35902508-35902530 GTAAAGGTAGAATGAGAAACAGG + Intergenic
1082898820 11:58223294-58223316 TCACAGGTATGTTGTGACACTGG - Intergenic
1084016992 11:66389707-66389729 TCAGAGTTATGGTGAGAAACAGG + Intergenic
1084757362 11:71248300-71248322 CAAGAAGTATGATGAGAAACTGG + Intronic
1085227846 11:74938485-74938507 GTAAAAGTATGATGAGAAACAGG - Intronic
1086275520 11:85123708-85123730 TGACAGGTTTTATGAGAAACGGG - Intronic
1086276191 11:85132751-85132773 ACAAAGGTAGGATAGGAAACAGG - Intronic
1086784122 11:90944474-90944496 TCAAAGGTATGTTGTTAATCAGG + Intergenic
1086868397 11:92007675-92007697 ACTAAGGGATGATGAGAAAATGG + Intergenic
1087294418 11:96353748-96353770 TCAAAGCAATGAAGACAAACTGG + Intronic
1087453895 11:98358622-98358644 TCAAATCAATAATGAGAAACTGG - Intergenic
1087515267 11:99152332-99152354 ACAAAGATATGATGAGACACAGG - Intronic
1087603702 11:100347963-100347985 TCAAAGGCATGATCTGAAAATGG - Intronic
1087708339 11:101520940-101520962 GCAAAGGAATGATCTGAAACTGG + Intronic
1088030661 11:105245391-105245413 TTAATGGTATCATTAGAAACTGG - Intergenic
1090563116 11:127955159-127955181 GTAAAAGTATGATGAGAAATGGG + Intergenic
1090793713 11:130115487-130115509 TCACAGGGATGATTAGAAATTGG + Intronic
1090812286 11:130256019-130256041 CCAAAGGTACGAAGAGAAGCTGG + Intronic
1090943753 11:131411425-131411447 TCAAAGGTAAGATGAGAAAGAGG + Intronic
1091502844 12:1035977-1035999 TAAAAAGTATGATGATAATCTGG - Intronic
1092664177 12:10776320-10776342 TCTAAGGTATAATTATAAACTGG - Intergenic
1092807439 12:12237461-12237483 ATAAAAGTATGATGAGAAACAGG + Intronic
1092812216 12:12282091-12282113 TCAAAAGTTTGATGAGGAATGGG + Intergenic
1094634649 12:32213875-32213897 GCAAAAGTATGATGAGAAACAGG - Intronic
1095966971 12:47874681-47874703 TGGAAGGCAAGATGAGAAACAGG - Intronic
1098062317 12:66576019-66576041 TCAAAGGTATGCTGAAAGGCTGG + Intronic
1098091380 12:66905582-66905604 TCAAAGGTTTTATGAGCAAGGGG + Intergenic
1098293769 12:68983568-68983590 TGGAAGTTGTGATGAGAAACTGG + Intergenic
1098399844 12:70063275-70063297 ATAAAGGTTTGATGATAAACAGG - Intergenic
1099326779 12:81226280-81226302 TCAGAGATATTATGAGAACCAGG - Intronic
1100028653 12:90160304-90160326 ACAAAGGTATGAGCAGAAAATGG - Intergenic
1100389301 12:94133690-94133712 TAAAAGGTAGGAGGAGAAAGTGG + Intergenic
1101986612 12:109452001-109452023 TCAAGGGGATGCAGAGAAACAGG + Intronic
1102593130 12:113972602-113972624 TCAAAGGTATTAAAAGAAAATGG + Intergenic
1103315612 12:120052680-120052702 GCAAAAGTTTCATGAGAAACAGG - Intronic
1105497709 13:20945269-20945291 TCAAAGGTATGATGGAGAAGTGG - Intergenic
1106575913 13:30974822-30974844 TGAAAAGTATGAAGAAAAACAGG - Intronic
1107610713 13:42110236-42110258 TCAAGGGTGGGATGGGAAACAGG - Intronic
1107787908 13:43972764-43972786 CCAGAGGTATGAGGAGGAACTGG - Intergenic
1108293336 13:48985464-48985486 GAAAATGTATGATGGGAAACTGG + Intronic
1108590624 13:51910009-51910031 TCAAATGAATGAAGAAAAACTGG - Intergenic
1108768322 13:53663084-53663106 ACAAAGATATGATATGAAACTGG + Intergenic
1110197105 13:72802704-72802726 TCAAAGGTATGTGGATATACAGG + Intronic
1110531912 13:76607685-76607707 GCAAAGGGAGGATGATAAACAGG - Intergenic
1110811824 13:79819633-79819655 CCAGAGGTATGAGGAGGAACTGG - Intergenic
1110814177 13:79843219-79843241 CCAGAGGTATGAGGAGGAACTGG + Intergenic
1111171477 13:84532249-84532271 TCAGAGGTATGAGGAGTAACAGG - Intergenic
1112275413 13:98013452-98013474 TAAAAGGAATGATGACAAACGGG - Intronic
1112853032 13:103730506-103730528 TCAAAGATATATTCAGAAACAGG + Intergenic
1113249033 13:108430851-108430873 TTGAAGGCATGATGAGAAACAGG - Intergenic
1116056415 14:39869577-39869599 TCAAAAGGATGATGAGGAAATGG + Intergenic
1116307004 14:43269283-43269305 TAATAGGTATGATCAGAGACTGG - Intergenic
1116332783 14:43616176-43616198 TTAAAGGTATAATGAGAGACTGG - Intergenic
1117142085 14:52799320-52799342 TCAAAGTTATGGTGAAAAACAGG + Intergenic
1118439630 14:65800758-65800780 TCAAAGCTGTGATCAGAGACGGG - Intergenic
1118563379 14:67112126-67112148 TCAAAAGCAAGATGAGAAAGAGG + Intronic
1119184053 14:72625108-72625130 GCAAAAGTATGATGAGAAGTAGG - Intronic
1119609747 14:76051815-76051837 CCAAAGGCATGAAGAAAAACTGG - Intronic
1120342642 14:83241907-83241929 TCATAGGTACTATGAAAAACTGG + Intergenic
1120540797 14:85747953-85747975 TGAAAGGTATAATGAAAACCGGG - Intergenic
1120847380 14:89138488-89138510 TAAAAGGTATGATGTGGAACAGG + Intronic
1123189463 14:106554662-106554684 TCTAAGTTATGATGAGGAGCAGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126734678 15:51718918-51718940 TAAAAGTTATGATCAGAACCGGG - Intronic
1127092467 15:55480589-55480611 TTAAAGGTATAATGAGAGACTGG - Intronic
1127496976 15:59522358-59522380 TCAGAAGTATGATGTAAAACTGG + Exonic
1129551951 15:76461394-76461416 ACAAATGTAGGATGAGAAAGAGG - Intronic
1129788529 15:78324950-78324972 TCAGTGGTAAAATGAGAAACTGG - Intergenic
1131793378 15:95988731-95988753 TCATAGCTCTGTTGAGAAACAGG - Intergenic
1134600738 16:15531628-15531650 TCAAAAAAATGATGAGAACCCGG - Intronic
1134877893 16:17718455-17718477 TCAAAGGTATAAGAAGAAAGGGG + Intergenic
1138600826 16:58053022-58053044 TCAAAAGTATACTGAGAACCAGG + Intergenic
1138713976 16:59000678-59000700 TCAAATTTCTGATGAGAAAATGG - Intergenic
1139651256 16:68363351-68363373 TCAAAGGTGAGATGAGGGACAGG + Intronic
1140554297 16:75903657-75903679 TCAAATGTCTGAGGAGAAAATGG + Intergenic
1142899249 17:3002303-3002325 TCAGAGGGGTGATGAGAAGCAGG + Intronic
1143041097 17:4037165-4037187 TAAATTGTTTGATGAGAAACAGG + Intronic
1144420782 17:15096370-15096392 TCACAGATCTGGTGAGAAACAGG + Intergenic
1146540874 17:33693620-33693642 TCAAAGGAATGTTGAGAACCAGG + Intronic
1146768372 17:35545058-35545080 TCAAATGTAAGATTAGGAACTGG - Intergenic
1146840101 17:36145827-36145849 TCAAAGGTTTCCTGTGAAACTGG + Intergenic
1148081340 17:44968861-44968883 TGGAAGGTAGGATGAGAAAGGGG + Intergenic
1148580706 17:48741582-48741604 CCAAAGTTATGATGAGCACCGGG + Intergenic
1149205138 17:54235103-54235125 TCAAAGGTATTATGAGAACAGGG + Intergenic
1150486493 17:65547287-65547309 TCAAAGGTCTCATGACCAACCGG + Intronic
1150718213 17:67590578-67590600 TGAAAAGTTTGATGAGGAACAGG + Intronic
1154175378 18:12084405-12084427 TCAAAGCTATTTTGAAAAACAGG - Intergenic
1156307894 18:35896208-35896230 TCAAAAGTTTGATGAGCAACAGG - Intergenic
1156577338 18:38333206-38333228 GCAAAAGTATGATGAGAAATAGG - Intergenic
1158150871 18:54368722-54368744 ACAAAAGTTTGAGGAGAAACAGG - Intronic
1158612363 18:58953026-58953048 TGAAAGGCATGAAGAGAAAAAGG + Intronic
1158783050 18:60675133-60675155 ACAAAAGTATGATGAAAAACAGG + Intergenic
1159062939 18:63535338-63535360 TCAAAGGTAGAATGGGAAAAAGG + Intergenic
1159090230 18:63839943-63839965 TGAAAGATATGATTAAAAACAGG - Intergenic
1159433854 18:68390249-68390271 TCAAAGGTAGGATAAAAATCAGG - Intergenic
1162211879 19:9098455-9098477 TTAAAGGTATGTAGAGAAAGAGG - Intergenic
1164756988 19:30696988-30697010 ACAAAGATATGATCAGAGACAGG + Intronic
1164892818 19:31839575-31839597 TGAAAGGTATGATGTGAAGTGGG - Intergenic
1166064997 19:40352543-40352565 TCACAGGTATAAAGAGAAATAGG - Intronic
1166739348 19:45104655-45104677 TCACAAGTGTGATGTGAAACAGG - Intronic
925260816 2:2526860-2526882 ACACAGGTAGGATGAGGAACAGG - Intergenic
925437281 2:3850406-3850428 TATTAGGTATGATGAGACACAGG + Intergenic
925753244 2:7108998-7109020 TCACATGTAAAATGAGAAACTGG + Intergenic
926289323 2:11516211-11516233 TCAAAGAGTTGAGGAGAAACTGG - Intergenic
926483781 2:13430951-13430973 GCAAAGGTATGCTGGAAAACAGG - Intergenic
926797913 2:16633943-16633965 TCAAAGGCAGGAGGAGAACCTGG + Intronic
926980822 2:18566160-18566182 TCAAAGATACTATGAGAAAAAGG - Intronic
927820877 2:26263789-26263811 TCAAACTTCTGAGGAGAAACAGG - Intronic
928011428 2:27611634-27611656 GCAACAGTATGATAAGAAACAGG - Intronic
928042826 2:27895675-27895697 ACAAAAGGATGATGAGAAACCGG - Intronic
928461218 2:31474580-31474602 TCAGGGGTCTGTTGAGAAACTGG - Intergenic
928727352 2:34190549-34190571 TTAAAAGTTTGATGAGTAACAGG - Intergenic
929193529 2:39162416-39162438 TCATCGGTATGCTGAGAAAATGG - Intergenic
930495469 2:52136310-52136332 TCAGAGGCATGCTGAGAAAGCGG + Intergenic
930686370 2:54312777-54312799 GCAAAAGCATGATGGGAAACAGG - Intergenic
930932918 2:56910230-56910252 TAAAAGGTCTAATGAGAAACTGG - Intergenic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
931890616 2:66667368-66667390 TCCAAGATATGATAAGAAATGGG - Intergenic
932869580 2:75384640-75384662 TTAAAGATATGAAAAGAAACAGG - Intergenic
933687118 2:85150830-85150852 GTAAAGGTTTGATGAGAAATGGG - Intronic
934965240 2:98715844-98715866 GTAAAAGTATGATAAGAAACAGG + Intronic
935527883 2:104194104-104194126 TCAAAGGTAAAGAGAGAAACTGG + Intergenic
935833524 2:107025107-107025129 TCCAAGGAATGAAGAGAAAGTGG - Intergenic
937010951 2:118562177-118562199 TTGAAAGTCTGATGAGAAACGGG + Intergenic
937501776 2:122487235-122487257 TCTGAGGTTTGATGAAAAACAGG + Intergenic
937715090 2:125023397-125023419 TCAGAGGTGTGATGATATACTGG - Intergenic
937953210 2:127404246-127404268 GCAAAAATATGATGAGAAACAGG + Intergenic
938197231 2:129339074-129339096 CCAAAGGTGTAATGAGACACAGG + Intergenic
938650916 2:133382542-133382564 TCAAAGGAATTATGAGGAGCAGG - Intronic
939319055 2:140592040-140592062 TCAAAGGAAACATGAGAAAGTGG - Intronic
941026315 2:160460154-160460176 TCAAAGTTATGACCAGAATCAGG - Intronic
941078041 2:161028714-161028736 TGGAAGGTAAGATGAAAAACAGG + Intergenic
941320249 2:164046016-164046038 GCAAAAGTATGATGAGAAACAGG + Intergenic
941671378 2:168297457-168297479 GCAAAAGCATGGTGAGAAACAGG - Intergenic
942017615 2:171832566-171832588 TTAGAGGTATAATGAGAGACTGG - Intronic
942244806 2:173998137-173998159 TCAAGGTTATGGTGAGATACAGG - Intergenic
942470998 2:176259515-176259537 ACAAAAGTATGATTACAAACAGG + Intergenic
943116085 2:183672406-183672428 TGAAAGCTATTTTGAGAAACAGG - Intergenic
943420190 2:187659663-187659685 TCTAAGTTATGAAGAAAAACTGG + Intergenic
943424340 2:187711216-187711238 TCAAAGCTATGAGAAGTAACAGG - Intergenic
943477974 2:188382994-188383016 TCAAAGTTATGACGGGAAGCAGG + Intronic
943988027 2:194647720-194647742 TCAAAGATATGATGGAAAATTGG - Intergenic
945587648 2:211686905-211686927 TCAAAGCCATCATGAAAAACAGG + Intronic
946076279 2:217076468-217076490 TCCAAGGACTGAAGAGAAACAGG - Intergenic
946263242 2:218514685-218514707 ACAAAAGTTTGATGAGAAACAGG - Intronic
946479910 2:220045148-220045170 TCAAAAGTATGAGTAAAAACAGG + Intergenic
946984385 2:225255902-225255924 TCCAAGGAAAGAAGAGAAACTGG - Intergenic
947032540 2:225813811-225813833 CCAAAAGTAGTATGAGAAACTGG + Intergenic
947559114 2:231130852-231130874 TCCAAGGTATTATAAGAAACTGG + Intronic
1170339538 20:15308204-15308226 TAAAAAGTTTGATGACAAACAGG - Intronic
1170497889 20:16944527-16944549 GTAAAAGTATGATGAGAAGCAGG - Intergenic
1172884730 20:38223409-38223431 TCAAATGAATGATGAAAAACAGG + Intronic
1173201144 20:40955911-40955933 TCAAGGGTATGAAGAAAATCCGG - Intergenic
1174733216 20:52938436-52938458 TGAAAGGAATGAAGAGAGACTGG + Intergenic
1175602438 20:60285952-60285974 TCAAAGGTAAAATGAGGAATTGG - Intergenic
1177786530 21:25677664-25677686 TCAAAGGTATGATGATACAGAGG + Intronic
1178553130 21:33559317-33559339 TTAAAGGGATGATGATAAAAAGG - Exonic
1179114815 21:38480507-38480529 TCACAGCTATCCTGAGAAACTGG + Intronic
1179282273 21:39944129-39944151 TCAAAGGAAGGAAGAGAGACTGG + Intergenic
1180753868 22:18146677-18146699 TTAAAAGTTTGATGAGAAACAGG - Intergenic
1181142735 22:20818980-20819002 ACAAAGGAATGAGAAGAAACAGG + Intronic
1182608135 22:31523502-31523524 TCTAAGGTGTGATGATAGACTGG - Intronic
1183767839 22:39895603-39895625 TCAAAGGAATGCTGAGAAGTAGG + Intergenic
949760925 3:7469658-7469680 TCACAGATATGATCAGAAACAGG - Intronic
949963766 3:9337455-9337477 TAAGAGGTAGGATGATAAACAGG + Intronic
952113350 3:30150035-30150057 TTAAAAGTTTGATGAGGAACAGG + Intergenic
952507569 3:34021269-34021291 TCAAAGGTATGAAGATAATTAGG + Intergenic
952746884 3:36790126-36790148 TCAAAGGACTGATGAAAAGCTGG - Intergenic
953432132 3:42848662-42848684 ACAAAAGCATGATGAGAAATAGG + Intronic
953720794 3:45353298-45353320 GCAAAAGAGTGATGAGAAACAGG - Intergenic
954171062 3:48802764-48802786 TTAAAGGTATGGAGAGAAAAAGG + Intronic
959195355 3:103173658-103173680 TAAAAGGTATGATGGGAAGAGGG - Intergenic
959738891 3:109693240-109693262 TCAAAGGAATGAGAAAAAACAGG - Intergenic
960455711 3:117868867-117868889 TCAAAGTTATCCTGAGAAATTGG + Intergenic
961333620 3:126157331-126157353 TCAAAGGGATGGTGAGGACCTGG - Exonic
962065487 3:131975249-131975271 TCAAAGTCATGAGGAGAAACAGG + Intronic
962132010 3:132689832-132689854 TCAAAGGAATCATGAAAAATTGG + Intronic
963361561 3:144279744-144279766 TTTAAGGTATCATGAGAAAGAGG + Intergenic
963831397 3:150013238-150013260 CCAAAGGCAGGATGAGAAATAGG + Intronic
963866329 3:150365800-150365822 TGAAAGTTTTGATGAGAAACAGG + Intergenic
965138376 3:164804017-164804039 TCAAAGGCATGATAAAAATCAGG + Intergenic
965362506 3:167758569-167758591 TCAAAGATATGATGAGTAACAGG + Intronic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
965417667 3:168417213-168417235 CCAAAGAAATGTTGAGAAACAGG - Intergenic
968870953 4:3241969-3241991 AAAAAGCTAGGATGAGAAACAGG - Exonic
971311495 4:25529336-25529358 TTACAGGTATGATTAGAAAGAGG + Intergenic
972503693 4:39700971-39700993 TAAAAGGTTTCATGAGAAATTGG + Intronic
972540711 4:40036707-40036729 TCAGTGGTTTGAGGAGAAACGGG + Intergenic
974158642 4:58107730-58107752 TCCAAGGTAAGAAGAAAAACTGG + Intergenic
975429538 4:74272437-74272459 TTAAGGGTAAAATGAGAAACTGG + Intronic
976076118 4:81300818-81300840 TCAAAGGTATTATTTGACACCGG + Intergenic
976662701 4:87556314-87556336 TCAAGGGCATGATGTAAAACTGG - Intergenic
976768128 4:88619871-88619893 TCAAATGGATGATGAAAAAGTGG - Intronic
977059320 4:92237690-92237712 TCAAATGCATTATGAAAAACAGG + Intergenic
977662304 4:99603913-99603935 TTAAAGATGTGATGAGAACCAGG - Intronic
978034671 4:103977865-103977887 TTAAAGGTATAATGAGAGATTGG - Intergenic
978184378 4:105839742-105839764 TCAAAGGAGGGATTAGAAACAGG - Intronic
980644339 4:135622813-135622835 TCAAGGATTTGTTGAGAAACAGG - Intergenic
980988327 4:139717292-139717314 TATAAGCAATGATGAGAAACTGG - Exonic
982232287 4:153220317-153220339 TAGAAGATATGATGAGAGACAGG + Intronic
982411773 4:155085829-155085851 TCAAAGGTAGGAAGAGAGAAGGG + Intergenic
982981082 4:162136295-162136317 TGTAAGGGATGATGAGAACCCGG + Intronic
984241172 4:177220923-177220945 GCAAAGATTTGAGGAGAAACAGG + Intergenic
984862205 4:184251454-184251476 TCAAAGGTATCCTGACAAACTGG + Intergenic
987224711 5:15828113-15828135 TTTCAGGTATGATGTGAAACTGG - Intronic
988448174 5:31311102-31311124 ACAAAGAGATGATGTGAAACTGG - Intronic
989170742 5:38468776-38468798 TCAGGGCTGTGATGAGAAACTGG - Intergenic
989255355 5:39360511-39360533 TCAAAGGAAGAATGACAAACTGG + Intronic
991379967 5:66010497-66010519 GTAAAAGTATGATGAAAAACAGG - Intronic
991546124 5:67783570-67783592 CCACAGGTATAAGGAGAAACTGG + Intergenic
991631467 5:68660667-68660689 GGAAAGGCATGATGGGAAACTGG + Intergenic
994843731 5:104958342-104958364 TCTAAGGCATGCAGAGAAACTGG + Intergenic
994888080 5:105592341-105592363 TCATTGGTATAATAAGAAACTGG + Intergenic
998166120 5:139845062-139845084 TCACAGGTATGATTAGGACCCGG - Intergenic
999533671 5:152491858-152491880 ATAAAAGTTTGATGAGAAACAGG - Intergenic
1000392259 5:160736328-160736350 GCAAAGGTATGATGATAAATGGG + Intronic
1001114064 5:168924128-168924150 TCAGAGGTGTGAAGAGAGACTGG - Intronic
1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG + Intergenic
1003667938 6:8128951-8128973 AAAAAAGTATAATGAGAAACTGG - Intergenic
1004564650 6:16784736-16784758 CCAAAGGTATGATTAGAAATTGG + Intergenic
1005078040 6:21927706-21927728 TGGAAGGGAGGATGAGAAACAGG - Intergenic
1005636614 6:27758912-27758934 TCAAAGCTATGTCTAGAAACTGG - Intergenic
1007334138 6:41139341-41139363 TCAAAGGACAGCTGAGAAACAGG - Intergenic
1007990729 6:46252808-46252830 TGAAGGGTATGAAGAAAAACTGG + Intronic
1008048222 6:46873316-46873338 GCAAAGACTTGATGAGAAACGGG - Intronic
1009815745 6:68732533-68732555 TTGAAGATATGGTGAGAAACAGG + Intronic
1010521428 6:76842955-76842977 TAAAAGGCATGATGAAAAAGAGG + Intergenic
1010830633 6:80524059-80524081 TTAAAGGTATTATGAGAAGGTGG + Intergenic
1010983103 6:82391994-82392016 TCAGAGGTATGAGGAGGAACTGG - Intergenic
1011028648 6:82897216-82897238 TCAAAGTTATGATCTGAAACAGG + Intronic
1011509666 6:88086714-88086736 TCAAACGGTTGATGAGAAATGGG - Intergenic
1011578003 6:88826139-88826161 CCAAAGGTATGAAAAGAAAAAGG + Intronic
1014678499 6:124398471-124398493 TGAAAGGTATGATGGAAAATAGG + Intronic
1015168950 6:130229576-130229598 TCATAGGTATTAAGAGAAACTGG + Intronic
1015232370 6:130930165-130930187 TGAAAGGAATAATGGGAAACAGG - Intronic
1015399819 6:132776554-132776576 TCAAAGGTAAGATGAAAATTAGG - Intronic
1015752655 6:136575934-136575956 GCAAAAGAATGAGGAGAAACAGG - Intronic
1017023370 6:150159922-150159944 ACAAAGGAAGGCTGAGAAACTGG - Intronic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1017970251 6:159306225-159306247 TTAAAGGCATGAAGAGATACTGG - Intergenic
1018110864 6:160535768-160535790 TCATATGTAAGATGAGAAAGCGG + Intronic
1018169591 6:161134110-161134132 TCAAATGACTGATGAGAAAGAGG + Exonic
1019877689 7:3829187-3829209 TCAAATTTATGATGAAAAAATGG + Intronic
1020363872 7:7358731-7358753 TCGATGGTATTATGACAAACAGG - Exonic
1021132346 7:16926352-16926374 TGAAAGGTATGCTTAAAAACAGG + Intergenic
1022974643 7:35545991-35546013 TCAAGGGCAGGATGAGGAACAGG + Intergenic
1024259947 7:47566674-47566696 TCAAAGGTAAGAAGGGAATCGGG + Intronic
1024469197 7:49749520-49749542 TTAAAAGTATGAGAAGAAACAGG + Intergenic
1026075284 7:67160905-67160927 TTTAAGGTATGATAAGACACAGG + Intronic
1026191098 7:68128485-68128507 TCAGAGTTTTGAGGAGAAACAGG + Intergenic
1026472884 7:70709341-70709363 TCATGGGTATCATGAGAAACTGG + Intronic
1026701566 7:72651300-72651322 TTTAAGGTATGATAAGACACAGG - Intronic
1027133832 7:75610533-75610555 TCAAACGTATTAAGAGAAATAGG - Intronic
1027457870 7:78416233-78416255 ACAATGGTATGATGAGAGGCAGG + Intronic
1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG + Intronic
1029049706 7:97672007-97672029 TTTAAGGTATAATGAGAAAGGGG + Intergenic
1029233319 7:99090091-99090113 GGAAAGGGATGGTGAGAAACAGG + Intronic
1030299156 7:107957798-107957820 AAAAAAGAATGATGAGAAACTGG + Intronic
1030314135 7:108097071-108097093 TGAAAGGTATGATGGGAAATTGG + Intronic
1030336476 7:108333247-108333269 TTAAATATATGATGAGAAAGAGG - Intronic
1030678313 7:112407904-112407926 TCAAAGGTGAGATAAGAAGCAGG - Intergenic
1032342260 7:131085693-131085715 TTAAAGGTGTGAGGAGTAACAGG + Intergenic
1032918563 7:136519675-136519697 TCAAAGGAAAGATGATTAACAGG - Intergenic
1033110951 7:138575581-138575603 TAAAAGGTTTGATGAACAACAGG - Intronic
1033726166 7:144120724-144120746 CCAGAGGTATAAGGAGAAACTGG + Intergenic
1033995987 7:147348502-147348524 TCACAAGTATGAAGAGAAAAGGG + Intronic
1035190208 7:157160714-157160736 GCAAAAGTTTGAGGAGAAACAGG - Intronic
1037626095 8:20608257-20608279 TAAAATGTTTGATGAGGAACAGG - Intergenic
1038609129 8:29043161-29043183 ACAAAGCAATGATGAGATACTGG - Intronic
1039562209 8:38521578-38521600 TTAAAAGTTTGATGAGAAACAGG - Intronic
1040682041 8:49822501-49822523 TAATATGTATGATGAGAAAATGG - Intergenic
1041053606 8:53960654-53960676 TGAAAGGTCTGATGAGAAAGGGG - Intergenic
1044307495 8:90654733-90654755 TAAAAGCTATGAGGAGAACCAGG + Intronic
1045453924 8:102356961-102356983 GCAAAAGTATGATGAGGAAGAGG + Intronic
1045640304 8:104242719-104242741 CCAAAGATCTGATTAGAAACAGG + Intronic
1045811835 8:106230941-106230963 TCAAAGGTATCATGGGATACTGG - Intergenic
1046082473 8:109388041-109388063 ACAAAGTTATCATGAGAAAGAGG - Intronic
1047621703 8:126614214-126614236 GCAAATGTATGACGAGAAACAGG - Intergenic
1048730962 8:137440617-137440639 CCAGAGGTATGTTAAGAAACTGG + Intergenic
1049991414 9:995169-995191 TCAAATGTATAAAAAGAAACAGG + Intergenic
1050283492 9:4077339-4077361 TAAAAGAGATGCTGAGAAACTGG + Intronic
1050319659 9:4438466-4438488 TCAAAGGGATGATGAGATGGTGG + Intergenic
1051599269 9:18856060-18856082 TGAAAGGCATGTTCAGAAACTGG + Intronic
1052059126 9:23939078-23939100 TTAAAGGGATGATTAAAAACTGG + Intergenic
1052308894 9:27042586-27042608 TTAAAAGCAAGATGAGAAACTGG + Intronic
1052367845 9:27633239-27633261 TAAAAGCTGTGATGAGGAACGGG - Intergenic
1053828851 9:42053987-42054009 ACAAAGGTTTGATGAGAAAGTGG + Intronic
1054601707 9:67133467-67133489 ACAAAGGTTTGATGAGAAAGTGG - Intergenic
1054705765 9:68460457-68460479 TCAAAGGTTTGAGGAGCAAAAGG - Intronic
1055824920 9:80312215-80312237 TCTAAGGTATGCAGAGAAAAGGG + Intergenic
1056885955 9:90444017-90444039 CCAAACATATGCTGAGAAACTGG - Intergenic
1057459689 9:95249863-95249885 TCTAAGAAATGAAGAGAAACTGG - Intronic
1057494458 9:95549795-95549817 GAAAAGGTATGATAAGAAAATGG - Intergenic
1058625980 9:106933059-106933081 TCAAAGCTGTGATGAGTAATGGG - Intronic
1058738038 9:107913877-107913899 TCAAACATATAATGAGAAAAGGG + Intergenic
1059074538 9:111178552-111178574 TCAACTCTATAATGAGAAACAGG + Intergenic
1059723415 9:116983705-116983727 TCAATGGGATGATGAGAGCCAGG + Intronic
1060354876 9:122896372-122896394 TCAAAGCTTTGACCAGAAACAGG - Intronic
1060569383 9:124624164-124624186 TCAAAGGTATGGTGACTCACAGG + Intronic
1187443598 X:19341792-19341814 GTAAATGTATGATGAGAAACAGG - Intergenic
1188387086 X:29574743-29574765 GCAAAGGGATGATCTGAAACTGG - Intronic
1190556052 X:51636988-51637010 ACAAAGGAATGATAAGAGACAGG - Intergenic
1192616987 X:72635703-72635725 TCAAATGTAAGATGACAAATGGG + Intronic
1194206359 X:91015875-91015897 GCAAAGCAATGATGAAAAACTGG - Intergenic
1194845595 X:98803815-98803837 ATAAAGGTAGGATGAGAAAAAGG - Intergenic
1195083653 X:101393928-101393950 ACTAATGTAAGATGAGAAACTGG + Intronic
1195779336 X:108443822-108443844 GCAAATATATGATGAGAAACAGG - Intronic
1196099900 X:111837124-111837146 TCAAAAGTAAGATGAGAGTCTGG + Intronic
1196775055 X:119330953-119330975 GGCAAAGTATGATGAGAAACAGG - Intergenic
1198810051 X:140526190-140526212 TCAAATGTTTGATGAAACACTGG + Intergenic
1199445710 X:147918212-147918234 GAAAAACTATGATGAGAAACAGG + Intronic
1199830434 X:151544400-151544422 TTAAAAGTAGGATGAAAAACAGG - Intergenic
1200552111 Y:4590696-4590718 GCAAAGCAATGATGAAAAACTGG - Intergenic
1201987112 Y:19980617-19980639 TTAAAGGCATAATGAGAGACTGG + Intergenic