ID: 965368192

View in Genome Browser
Species Human (GRCh38)
Location 3:167825225-167825247
Sequence GTTTACTTCTGAACCAATAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965368192 Original CRISPR GTTTACTTCTGAACCAATAC AGG Exonic
909193486 1:72585972-72585994 ATATACTTCTGAAACAACACAGG - Intergenic
910944690 1:92577516-92577538 GTTTTCATCTGAACCAAAGCCGG + Intronic
911652987 1:100410722-100410744 TTTTACTTCTGAATTAATAGAGG + Intronic
916779784 1:168012339-168012361 GTTTTCTTCTGAAAGATTACAGG - Intronic
918530705 1:185518352-185518374 GTTGACTTCAAAAGCAATACAGG - Intergenic
921474775 1:215593203-215593225 GTTCATTTCTTAACCAATTCTGG + Intronic
921915000 1:220597728-220597750 TTTTACTTTTTAAACAATACAGG - Intronic
1066279398 10:33900435-33900457 GTTTACCCCAGAATCAATACTGG + Intergenic
1067941876 10:50663496-50663518 GTTTGCTTCTCACCCAATAGAGG + Intergenic
1068576525 10:58689969-58689991 GATTACTTCTTATCCCATACAGG - Intronic
1070863121 10:79688450-79688472 GTTTGCTTCTCACCCAATAGAGG + Intergenic
1074990490 10:118701868-118701890 GTCTACTTCTGAACCAAAGGTGG - Intronic
1075938449 10:126365246-126365268 GTTTACTTCTGAACCTAAGAGGG + Intronic
1078646482 11:13145505-13145527 GTTTACTTCTCTACCTATGCCGG - Intergenic
1081656454 11:44860819-44860841 CTTTACTTCTGACCCACCACTGG - Intronic
1082931013 11:58605159-58605181 GTTTACTACTGAAGCTAAACTGG - Intronic
1083321496 11:61850164-61850186 TTGTACTTCTGAACCATAACAGG + Intronic
1085176930 11:74496627-74496649 GTTTATTCCTCTACCAATACAGG + Intronic
1088834384 11:113565806-113565828 TTGTTCTTCTGAACAAATACTGG - Intergenic
1102359761 12:112274834-112274856 GTTTATTTCTTACCCAATCCTGG + Exonic
1102810014 12:115816042-115816064 GTTGAGTACTGAACCAATCCAGG - Intergenic
1105557042 13:21457281-21457303 CTTTACTTCAAAACCACTACGGG + Intronic
1107001531 13:35551707-35551729 CTGAACCTCTGAACCAATACTGG - Intronic
1108118284 13:47154510-47154532 GTCTACTCCTGAACCAATCAGGG + Intergenic
1108797008 13:54044097-54044119 GTACACTTCTGAACAAATAATGG + Intergenic
1108822940 13:54376201-54376223 TTTTATTTCTGAGCCAATCCTGG + Intergenic
1109726039 13:66343158-66343180 GTAAACTTCTGAAAGAATACTGG + Intronic
1110682182 13:78327876-78327898 CTTGACTTTTTAACCAATACAGG - Intergenic
1112220416 13:97483989-97484011 GTTTGTTTCTGATCCAATACAGG - Intergenic
1116258636 14:42590837-42590859 GTTTATTTCTGTGCCAATATAGG - Intergenic
1121170285 14:91848107-91848129 GCTTATTTTTGAACCAATACTGG + Intronic
1122745422 14:103894669-103894691 GTTTCCTTCTGACTCAGTACTGG + Intergenic
1125042726 15:35210452-35210474 GTTTACTCATGGACCAATAAAGG + Intergenic
1139315304 16:66062527-66062549 GTTTACCTCTGATCCAAACCTGG - Intergenic
1154342569 18:13516396-13516418 GGTGACATCTGAACAAATACAGG - Intronic
1157461088 18:47894623-47894645 GTTTCCTTCTGGAGGAATACTGG - Intronic
1160276000 18:77436596-77436618 GTTTACTTCTTGAGAAATACTGG + Intergenic
935005019 2:99065723-99065745 GTTTACTTCTGAGCAATTTCAGG - Intronic
935495073 2:103770916-103770938 GTTGACTTCTGAACCCTAACAGG + Intergenic
938646226 2:133333141-133333163 GTGCACTTCTGAACTAATTCTGG - Intronic
939386134 2:141500846-141500868 GTTTATTTCTAAAGCAATAGAGG - Intronic
940643022 2:156366952-156366974 GTCTACTTCTCAACCAATCAAGG + Intergenic
944407541 2:199401950-199401972 TTTTACTTCTGATCCACTTCAGG - Intronic
945252225 2:207773228-207773250 GTTTTCTTCAGAACCTTTACTGG - Intergenic
947882160 2:233526397-233526419 ATTTATTTCTGAGCCAATTCTGG - Intronic
1177350642 21:19936377-19936399 GCTTATATCTTAACCAATACAGG + Intergenic
1179134846 21:38670305-38670327 GTTTGGTTCTGCACCAATGCTGG - Intergenic
955692267 3:61602516-61602538 GTTCAGTTTTTAACCAATACAGG - Intronic
958522956 3:95214757-95214779 GTTTAGTTCTGAATCAAAAACGG - Intergenic
963548919 3:146696681-146696703 CTTTACTTCTAAACCTATAATGG - Intergenic
965368192 3:167825225-167825247 GTTTACTTCTGAACCAATACAGG + Exonic
965496079 3:169400967-169400989 GTTTCCATCTGAACCATTACTGG - Intronic
973042370 4:45486557-45486579 GTTTTCTTATCAATCAATACAGG + Intergenic
978046194 4:104131093-104131115 GTTGACATTAGAACCAATACAGG + Intergenic
982128621 4:152206466-152206488 TTTTATTTCTAAACCAACACGGG - Intergenic
982380867 4:154745484-154745506 GATGACTTCTGCAGCAATACTGG - Intronic
983015773 4:162609752-162609774 ATTTTATTCTGAACCAATATGGG - Intergenic
983749980 4:171256071-171256093 TTTCACTTCTGAACAAATAGTGG + Intergenic
990482063 5:56220989-56221011 ATTTGCTTCTAAACCAGTACTGG + Intronic
991909158 5:71544474-71544496 GTTTACTTCTGAAGAAATACTGG - Exonic
1003772009 6:9316091-9316113 TTTTAATTCTGAAACAAAACTGG - Intergenic
1007898765 6:45390395-45390417 TTTTTCTTCTGAACAACTACAGG + Intronic
1016651222 6:146463147-146463169 ATTTACATCTGTGCCAATACTGG + Intergenic
1022434473 7:30368178-30368200 GTTTACTTTTTAACCTATATTGG + Intronic
1023555738 7:41421082-41421104 GTTTGCTTCTGAGCCAGTCCTGG + Intergenic
1035777711 8:2202310-2202332 GTTTATTTCAGAACCAACAGAGG - Intergenic
1037773011 8:21813912-21813934 TTTTTATTCTGAACCTATACAGG - Intergenic
1041142240 8:54834469-54834491 GTTTCCTTCTGAAACTAAACAGG - Intergenic
1042167011 8:65955715-65955737 GTGTATTTCTGTACCAATAATGG + Intergenic
1042942995 8:74126272-74126294 GTTCACTTCTAAACCAATGGGGG - Intergenic
1045989962 8:108295489-108295511 GGTTACTCCTGGGCCAATACTGG - Intronic
1046157560 8:110312943-110312965 GTTTACTTCTGTAAAAATAGAGG + Intergenic
1048229606 8:132625321-132625343 GTTTACTCCTGAATCAAGATTGG - Exonic
1051953945 9:22666965-22666987 GTTTTCTTCTCCACCAGTACTGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1053026526 9:34733923-34733945 GTGTAATTCTTAACTAATACAGG - Intergenic
1056762815 9:89427086-89427108 ATCTACCTCTGACCCAATACTGG - Intronic
1060902738 9:127275172-127275194 GTTTTCTTCTGAACTCATGCAGG + Intronic
1061653476 9:132069611-132069633 GTGTACTTCAGAAACATTACTGG + Intronic
1188657704 X:32718056-32718078 GTGGACTTTTGAACTAATACTGG + Intronic
1194580323 X:95663739-95663761 GTTTATTTCTGAAACAAAACAGG + Intergenic
1195852906 X:109302548-109302570 TCTGACTTCTGAAACAATACGGG + Intergenic
1197206772 X:123797820-123797842 GTATACATCAGAGCCAATACGGG + Intergenic
1200385544 X:155886907-155886929 GTTTCCTTCTGAACCTGCACAGG + Intronic
1201726034 Y:17152956-17152978 GTCTACTTTTATACCAATACTGG - Intergenic