ID: 965369995

View in Genome Browser
Species Human (GRCh38)
Location 3:167850093-167850115
Sequence CTTGAACTCAACCACTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965369991_965369995 8 Left 965369991 3:167850062-167850084 CCTTCTCTTGTCTTTAAATTGTC No data
Right 965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG No data
965369989_965369995 10 Left 965369989 3:167850060-167850082 CCCCTTCTCTTGTCTTTAAATTG No data
Right 965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG No data
965369990_965369995 9 Left 965369990 3:167850061-167850083 CCCTTCTCTTGTCTTTAAATTGT No data
Right 965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG No data
965369988_965369995 20 Left 965369988 3:167850050-167850072 CCTTCATGAGCCCCTTCTCTTGT No data
Right 965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965369995 Original CRISPR CTTGAACTCAACCACTGCCA TGG Intergenic
No off target data available for this crispr