ID: 965370413

View in Genome Browser
Species Human (GRCh38)
Location 3:167855277-167855299
Sequence GTTGAGATCTCCAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965370404_965370413 21 Left 965370404 3:167855233-167855255 CCAGGTGTTGTGAATGCAAAGGT No data
Right 965370413 3:167855277-167855299 GTTGAGATCTCCAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965370413 Original CRISPR GTTGAGATCTCCAGGGAGGT GGG Intergenic
No off target data available for this crispr