ID: 965371747

View in Genome Browser
Species Human (GRCh38)
Location 3:167871264-167871286
Sequence GATGACCTACTATCAAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965371741_965371747 16 Left 965371741 3:167871225-167871247 CCTGGGTATGGGGCATGACTCCT No data
Right 965371747 3:167871264-167871286 GATGACCTACTATCAAATAAGGG No data
965371745_965371747 -4 Left 965371745 3:167871245-167871267 CCTTCTGGAATTAGGGTTTGATG No data
Right 965371747 3:167871264-167871286 GATGACCTACTATCAAATAAGGG No data
965371740_965371747 19 Left 965371740 3:167871222-167871244 CCTCCTGGGTATGGGGCATGACT No data
Right 965371747 3:167871264-167871286 GATGACCTACTATCAAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965371747 Original CRISPR GATGACCTACTATCAAATAA GGG Intergenic
No off target data available for this crispr