ID: 965372384

View in Genome Browser
Species Human (GRCh38)
Location 3:167879679-167879701
Sequence TTGTGTGCATGAGGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965372384_965372390 -8 Left 965372384 3:167879679-167879701 CCTCTCTCCCCTCATGCACACAA No data
Right 965372390 3:167879694-167879716 GCACACAAAGATGAGGTCATGGG No data
965372384_965372389 -9 Left 965372384 3:167879679-167879701 CCTCTCTCCCCTCATGCACACAA No data
Right 965372389 3:167879693-167879715 TGCACACAAAGATGAGGTCATGG No data
965372384_965372392 30 Left 965372384 3:167879679-167879701 CCTCTCTCCCCTCATGCACACAA No data
Right 965372392 3:167879732-167879754 GATAGCCACCTGCAACCCAAGGG No data
965372384_965372391 29 Left 965372384 3:167879679-167879701 CCTCTCTCCCCTCATGCACACAA No data
Right 965372391 3:167879731-167879753 TGATAGCCACCTGCAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965372384 Original CRISPR TTGTGTGCATGAGGGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr