ID: 965375965

View in Genome Browser
Species Human (GRCh38)
Location 3:167924408-167924430
Sequence CTGTAGACCTTCAAAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965375965_965375970 13 Left 965375965 3:167924408-167924430 CCTTGATCTTTGAAGGTCTACAG No data
Right 965375970 3:167924444-167924466 CTAACTCAGTGCTGGGCAAATGG No data
965375965_965375968 5 Left 965375965 3:167924408-167924430 CCTTGATCTTTGAAGGTCTACAG No data
Right 965375968 3:167924436-167924458 GGTCTAGGCTAACTCAGTGCTGG No data
965375965_965375967 -10 Left 965375965 3:167924408-167924430 CCTTGATCTTTGAAGGTCTACAG No data
Right 965375967 3:167924421-167924443 AGGTCTACAGCAAGTGGTCTAGG No data
965375965_965375969 6 Left 965375965 3:167924408-167924430 CCTTGATCTTTGAAGGTCTACAG No data
Right 965375969 3:167924437-167924459 GTCTAGGCTAACTCAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965375965 Original CRISPR CTGTAGACCTTCAAAGATCA AGG (reversed) Intergenic
No off target data available for this crispr