ID: 965377582

View in Genome Browser
Species Human (GRCh38)
Location 3:167944680-167944702
Sequence TGACTTCTATGGTTTCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965377582_965377593 29 Left 965377582 3:167944680-167944702 CCAACAAGAAACCATAGAAGTCA No data
Right 965377593 3:167944732-167944754 AGTTTGAAAATAGACCCAAGGGG No data
965377582_965377588 -1 Left 965377582 3:167944680-167944702 CCAACAAGAAACCATAGAAGTCA No data
Right 965377588 3:167944702-167944724 AGTACCCTGGGCAAAAGGAAGGG No data
965377582_965377587 -2 Left 965377582 3:167944680-167944702 CCAACAAGAAACCATAGAAGTCA No data
Right 965377587 3:167944701-167944723 CAGTACCCTGGGCAAAAGGAAGG No data
965377582_965377591 27 Left 965377582 3:167944680-167944702 CCAACAAGAAACCATAGAAGTCA No data
Right 965377591 3:167944730-167944752 AAAGTTTGAAAATAGACCCAAGG No data
965377582_965377592 28 Left 965377582 3:167944680-167944702 CCAACAAGAAACCATAGAAGTCA No data
Right 965377592 3:167944731-167944753 AAGTTTGAAAATAGACCCAAGGG No data
965377582_965377586 -6 Left 965377582 3:167944680-167944702 CCAACAAGAAACCATAGAAGTCA No data
Right 965377586 3:167944697-167944719 AAGTCAGTACCCTGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965377582 Original CRISPR TGACTTCTATGGTTTCTTGT TGG (reversed) Intergenic
No off target data available for this crispr