ID: 965379141

View in Genome Browser
Species Human (GRCh38)
Location 3:167966775-167966797
Sequence AGGGAAAGCACAGTGATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965379135_965379141 11 Left 965379135 3:167966741-167966763 CCTGGTGTGGAGAGAGAATCTGT No data
Right 965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG No data
965379133_965379141 24 Left 965379133 3:167966728-167966750 CCAGCAGCAGACACCTGGTGTGG No data
Right 965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965379141 Original CRISPR AGGGAAAGCACAGTGATTTT AGG Intergenic
No off target data available for this crispr