ID: 965382272

View in Genome Browser
Species Human (GRCh38)
Location 3:168004708-168004730
Sequence GAGTAGGAATGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965382272_965382280 18 Left 965382272 3:168004708-168004730 CCTCCTTCCCTCCATTCCTACTC No data
Right 965382280 3:168004749-168004771 CATTCTTGTCTGCTGCAACTTGG No data
965382272_965382277 -8 Left 965382272 3:168004708-168004730 CCTCCTTCCCTCCATTCCTACTC No data
Right 965382277 3:168004723-168004745 TCCTACTCCTTTTTATGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965382272 Original CRISPR GAGTAGGAATGGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr