ID: 965388257

View in Genome Browser
Species Human (GRCh38)
Location 3:168072030-168072052
Sequence TGGACTCTGGATTTCCCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965388251_965388257 10 Left 965388251 3:168071997-168072019 CCTAGAGAAAAAGTTTAATTTTA 0: 1
1: 1
2: 8
3: 110
4: 848
Right 965388257 3:168072030-168072052 TGGACTCTGGATTTCCCATAGGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965388257 Original CRISPR TGGACTCTGGATTTCCCATA GGG Intronic
902793533 1:18785181-18785203 TGGAGCCTGGAGTTCCCATGTGG - Intergenic
904575132 1:31500490-31500512 TGGACTCTGCTCTTCCCATAGGG + Intergenic
905999264 1:42409918-42409940 TGGACTCTGTACTTGCCATCTGG - Intronic
907098643 1:51806448-51806470 TGGACACTGGAGTGTCCATAAGG + Intronic
912085116 1:105991496-105991518 TGCACTCTGGATTCCATATATGG + Intergenic
915003835 1:152618688-152618710 GGGACTCAGGTGTTCCCATAAGG - Intergenic
916317639 1:163468121-163468143 TAAACTCTGGATTTCCTTTATGG - Intergenic
918359853 1:183745738-183745760 TGGAAACTGCATTTTCCATATGG + Intronic
918564636 1:185914239-185914261 TTGACTTTGGATTTCCCTTTTGG + Intronic
920852688 1:209639282-209639304 TGGGCTCTGGAGTTACAATAGGG + Intronic
922730322 1:227946002-227946024 TGCCCTCTGGACTTCCCACAGGG + Intronic
1068140960 10:53006794-53006816 TGGAGTCTGTGTTTCCCATATGG - Intergenic
1072755152 10:98015374-98015396 TGGATTATGGAGTTTCCATATGG + Intronic
1075463854 10:122636892-122636914 TGGACTCAGGATTTCTCTGATGG - Intronic
1075907339 10:126093080-126093102 TGCTCTCTGGGTTTCCCAAAAGG - Intronic
1077832385 11:5887906-5887928 TGGATTCTGTGTTTCCCAGATGG - Intronic
1077933269 11:6755280-6755302 TGGTCTCTGGAGTTCCAATAAGG + Intergenic
1081044469 11:38254061-38254083 TGGACTGTGGAGTTCCTTTAAGG - Intergenic
1083247042 11:61436740-61436762 TGGTTTCTGGATTTCTCACAGGG + Intronic
1086416310 11:86591921-86591943 TGGACTCTAGATGTCTGATATGG - Intronic
1087150684 11:94856784-94856806 TGGACTCACCACTTCCCATAGGG + Intronic
1089302360 11:117506213-117506235 TGAACTCTGGGTCTCCCACAGGG + Intronic
1092525244 12:9305838-9305860 GGGACTCTGGAGTTCCCTGAGGG - Intergenic
1093583568 12:20810254-20810276 TGGACACTGGATATCTCACATGG - Intergenic
1093675802 12:21939308-21939330 TGGACTCTGGATGTTGGATAAGG - Intronic
1094510982 12:31096460-31096482 GGGACTCTGGAGTTCCCTGAGGG - Intronic
1099004588 12:77220976-77220998 TGGACTCTGCATTTTTCTTAAGG + Intergenic
1111482539 13:88850352-88850374 TGGATTTTGGACTTCTCATAAGG - Intergenic
1112762209 13:102704190-102704212 TGGAGTCTGTGTTTCCCAGATGG + Intergenic
1113640347 13:111952872-111952894 TGGCCTCTGGCTTTTCCCTAGGG - Intergenic
1115598762 14:34935368-34935390 TTGGCTCTGGGTTTCTCATAAGG + Intergenic
1116321901 14:43478733-43478755 TGGACTCTGCATTTTTCAAAAGG + Intergenic
1116536964 14:46043589-46043611 TGGACTCTGGTTTTATCAAAGGG - Intergenic
1118372419 14:65148905-65148927 GGGACTCCAGATTTCCCATTTGG + Intergenic
1122152932 14:99734443-99734465 TGGACTCTGGCAGTCTCATAGGG + Intergenic
1124241416 15:28031242-28031264 TGGATTCTGTGTTTCCCAAATGG + Intronic
1127913095 15:63434592-63434614 AGGACTTTGGATTTTACATATGG - Intergenic
1129055791 15:72819303-72819325 TGGTCTCTGCATTTCCCACCTGG + Intergenic
1130562264 15:84967961-84967983 TGGAGTCAGGATTTCCTATCTGG + Intergenic
1143058764 17:4182410-4182432 TGGACTCTGGAATGCCCAGAAGG - Intronic
1144215344 17:13050315-13050337 TGGATTCTGGGTTTCCCCCATGG + Intergenic
1146796780 17:35787195-35787217 TGGGCTCTGGCTTTCAAATAGGG + Intronic
1147793443 17:43027018-43027040 TGGAGTCTGGGTTTCCCAAGTGG - Intronic
1148900563 17:50872986-50873008 TGGCCTCTGAATTTCCCCTGTGG + Intergenic
1149200903 17:54184756-54184778 TTGATTCTGTATTTCCCAGAGGG + Intergenic
1149519331 17:57306492-57306514 TAGATTCTGGAGTTCCCATCAGG + Intronic
1154094517 18:11399510-11399532 TGGGATCTGGCTGTCCCATAGGG + Intergenic
1156931889 18:42655017-42655039 TGGACTCTAGACATCCCAAAGGG - Intergenic
1157395126 18:47335093-47335115 TGGACATTGGAGTTCCCATTGGG + Intergenic
1157836880 18:50912091-50912113 TGGAATCTGGGTTTCGCATTTGG + Intronic
1159137479 18:64352997-64353019 TGGAATCTTGATTTCCCCCAAGG - Intergenic
1161440913 19:4291204-4291226 TGGAACCTGAATCTCCCATAGGG + Intergenic
1164632285 19:29769472-29769494 GGGATTCTGGATTTGCCCTAAGG - Intergenic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
929482035 2:42318449-42318471 TGGACTCTGGTTTTAATATATGG - Intronic
929579798 2:43074611-43074633 TGGACAATGGTTTTCCCAAATGG - Intergenic
930963868 2:57295527-57295549 TTGACTCTGCATTTCCCAATAGG - Intergenic
933097739 2:78209102-78209124 TAGACTCTGGATACCCCAAAGGG + Intergenic
940004698 2:148999762-148999784 TGGACTCTGGGTTTTCCTTCTGG + Intronic
942861486 2:180618441-180618463 TGGACTCTTGAGTGCTCATATGG - Intergenic
944889149 2:204098805-204098827 TGGACTCTCTTTTTCCCATTGGG + Intergenic
947332405 2:229044126-229044148 TAAACTCTGGATTTTCCATGTGG + Intronic
1170096737 20:12653552-12653574 TGTACTTTGTATTTCTCATAAGG + Intergenic
1171164445 20:22957821-22957843 TGGACTATGGGTGCCCCATAAGG + Intergenic
1171442524 20:25176735-25176757 TGGACCCTGGCATTCCCACAGGG - Intergenic
1172641164 20:36441152-36441174 AGGACTCTGGCTTTCCCTCAGGG - Intronic
1176914408 21:14607999-14608021 TGGACTCTGTCTTTACCACATGG - Intronic
1178087436 21:29126114-29126136 AGGACTCTGCATGTGCCATACGG + Intronic
1178497605 21:33100724-33100746 TGTAGTCTGGATTCCACATAGGG + Intergenic
1180135279 21:45858314-45858336 AAGAATCTGCATTTCCCATAAGG + Intronic
1183791191 22:40071507-40071529 TGGACTTTGGTATTACCATAAGG + Intronic
949525655 3:4900741-4900763 TGGGGCCTGGATTTCTCATATGG + Intergenic
950392336 3:12706455-12706477 AGGAATCAGGATTTCCCATAGGG + Intergenic
954127473 3:48539871-48539893 TGGGGACTGGATTTCTCATAAGG + Intronic
955251822 3:57290433-57290455 TGTACTCTGGATTACCCAGGTGG - Intronic
955614176 3:60788333-60788355 TCAACCCTGGATTTCCCCTAGGG + Intronic
956717303 3:72089534-72089556 CAGACTCTGGACTTCCCATGAGG - Intergenic
965388257 3:168072030-168072052 TGGACTCTGGATTTCCCATAGGG + Intronic
966357190 3:179093515-179093537 TGGACTCTGGATTTGAAATTGGG + Intergenic
966589386 3:181664047-181664069 TTGACTCTGGTTGTCTCATATGG - Intergenic
972697832 4:41465230-41465252 TGGACTTTGGAGTTCCAAAAAGG - Intronic
976472855 4:85449775-85449797 TTCACTCTGGATATCCCACATGG - Intergenic
987031763 5:13982943-13982965 TGGTCTCCTGATTTCCCAAAAGG + Intergenic
990683145 5:58268597-58268619 TGACCTCTGATTTTCCCATAGGG + Intergenic
994513856 5:100744486-100744508 TGATCTTTGGATTTCACATAGGG - Intergenic
995778550 5:115751529-115751551 TGGAGTCTGTATTTTCCAAATGG - Intergenic
996314118 5:122142064-122142086 TGTCCTCTGGATTTTCCATTTGG - Intronic
998351690 5:141506030-141506052 AGGATTCTGGTTTTCCCATAAGG + Intronic
1003529220 6:6924139-6924161 TGGACACAGGATCTACCATATGG + Intergenic
1004504299 6:16235419-16235441 TGAACTCTGGATATCACTTATGG + Intergenic
1005694706 6:28341137-28341159 TTGATTCTGGAATTCTCATAAGG - Intronic
1006604926 6:35249254-35249276 TGAGCTCTGGACTTCCCACATGG + Exonic
1008684691 6:53911915-53911937 TATAGTGTGGATTTCCCATATGG - Intronic
1013703771 6:112807416-112807438 TGCACTCTGAATCTCCCAGAGGG - Intergenic
1018901427 6:168053739-168053761 TGGACTCTGGGTTCCCCAGGCGG - Intergenic
1021234838 7:18130148-18130170 TGGATTCTGGATTTCAAATTAGG - Intronic
1021867987 7:24978133-24978155 TGGACCCTCAATTTCCCATCTGG + Intronic
1022355835 7:29613624-29613646 TGAACTCTGGAATTCCTATTTGG + Intergenic
1022857386 7:34328789-34328811 AGGAGTCTGGATTTCCTTTAGGG + Intergenic
1024037762 7:45523389-45523411 TGAACAGTGGATTGCCCATAAGG + Intergenic
1024984012 7:55180504-55180526 TGCAGCATGGATTTCCCATAGGG + Intronic
1035704484 8:1664627-1664649 TGGTCTCTGGAAAACCCATATGG + Intronic
1037010892 8:13841028-13841050 TGGACTCTAAATTTCTTATAAGG - Intergenic
1038558301 8:28544906-28544928 AGGACTCTGCAGTTCCCATCAGG - Intronic
1039727187 8:40231156-40231178 TGGAGTCTGTATTTCCCAGGTGG - Intergenic
1039805109 8:40991036-40991058 TGGAGTCTGTGTTTCGCATATGG + Intergenic
1039863825 8:41483519-41483541 TGGAGTCTGGTTTTCCCGGATGG + Intergenic
1040372932 8:46794902-46794924 TGGACTCTGGAATTCCAGTTGGG - Intergenic
1041551396 8:59105640-59105662 TGGACTTAGGATATCCCATAGGG - Intronic
1042530847 8:69813526-69813548 TAGACTCTGAATTTACCATCAGG + Intronic
1044307065 8:90650043-90650065 TGGGCTCTGGATTTCCAGTTAGG + Intronic
1045051910 8:98335069-98335091 TGGACTCTGCATTCCCTAAATGG + Intergenic
1047604848 8:126464963-126464985 TGGAGTCTGTGTTTCCCAAATGG + Intergenic
1049318838 8:141984930-141984952 TGGACTATGGATGGCCAATATGG - Intergenic
1051245323 9:15104664-15104686 TGGTCTCTGGAGTTCTCACAGGG - Intergenic
1052310570 9:27063853-27063875 TGAACTCTGGATTACTAATATGG + Intergenic
1052443499 9:28529117-28529139 TGGTCTCTGTAGTTCCCAGATGG - Intronic
1054956641 9:70918871-70918893 CTGACTCTGGCTTTCCCAAATGG - Intronic
1061331956 9:129900335-129900357 TGGAATCTGGAATGACCATAAGG - Intronic
1061513076 9:131072609-131072631 TGGGCTGTGGGCTTCCCATAGGG + Exonic
1190995854 X:55607739-55607761 TGGACTCTGGATTTTCAAGCAGG - Intergenic
1193523233 X:82556313-82556335 TGTACTATGAAATTCCCATAGGG - Intergenic
1199696443 X:150345936-150345958 TGGGCTATAAATTTCCCATATGG - Intergenic
1202266825 Y:23028347-23028369 TGGACTCTGGAATTCCAGTTGGG - Intergenic
1202419818 Y:24662092-24662114 TGGACTCTGGAATTCCAGTTGGG - Intergenic
1202450968 Y:25007992-25008014 TGGACTCTGGAATTCCAGTTGGG + Intergenic