ID: 965388973

View in Genome Browser
Species Human (GRCh38)
Location 3:168081381-168081403
Sequence TTCCATGGACATAGTAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965388973 Original CRISPR TTCCATGGACATAGTAGGCA GGG Intronic
902552826 1:17229416-17229438 TCCCATGTCCATAGCAGGCAAGG - Intronic
904005899 1:27363058-27363080 GTCCCTGGACAGAGTAGGCCAGG - Intronic
904429546 1:30453210-30453232 TTCCATAGAAACAGCAGGCATGG - Intergenic
905652049 1:39663046-39663068 TTCCATGGAAACAGAAGGCTGGG + Intronic
907064561 1:51467837-51467859 TTCCATGGACCTGGGAGGGATGG - Intronic
909699033 1:78499759-78499781 TTTCATGGACATACTAGGCTTGG + Intronic
910888289 1:91989654-91989676 TTTAAAGGACATATTAGGCAGGG - Intronic
911303582 1:96205801-96205823 TTTCAAGGACATACTAGGCGAGG - Intergenic
911795528 1:102070865-102070887 TTCAATGGATAAGGTAGGCATGG + Intergenic
912626551 1:111209477-111209499 TACCTTGCACATAGTAGGAATGG - Intronic
918402351 1:184176103-184176125 TCCCAGGGACAGAGTAGACAAGG + Intergenic
922069260 1:222174805-222174827 TGCTATGGACATAGAAGGCCAGG - Intergenic
924502652 1:244652019-244652041 TTGCTGGGACACAGTAGGCAAGG - Intergenic
924632921 1:245759381-245759403 TTCCATGGACTTAGTATCCATGG - Intronic
1063332094 10:5170047-5170069 TTCCATGGACTCACTAGACATGG + Intergenic
1065085542 10:22171791-22171813 TTCCATTGACCCACTAGGCAGGG + Intergenic
1068031635 10:51711917-51711939 TTCCATATACATTGTAGGGAAGG + Intronic
1068067952 10:52155848-52155870 TTATATGGACATATTAGACATGG + Intronic
1070599227 10:77854142-77854164 TTCTCTGGACTTAGTAGCCAGGG - Intronic
1070707291 10:78649606-78649628 TTCCTGGCACATAGTAGGCTTGG - Intergenic
1076518361 10:131062760-131062782 TACCATGGACCTGGGAGGCAGGG - Intergenic
1077534281 11:3112998-3113020 ATACATAGACATATTAGGCATGG - Intronic
1077842052 11:5986111-5986133 TTCCAGGGACATAGAAGACCAGG + Exonic
1077957902 11:7040489-7040511 TTCCATGGATGTAGGAGGCAGGG - Intronic
1082767686 11:57181965-57181987 TTCCATGGACACAGTCCTCATGG + Exonic
1084499632 11:69527393-69527415 TTGTATGTACATAGTAGGCTGGG + Intergenic
1084890993 11:72237193-72237215 CTTCAAGGACGTAGTAGGCAGGG - Exonic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1086947553 11:92858107-92858129 TTCCTTGCACATACTAGGCATGG - Intronic
1087264991 11:96050755-96050777 CTCCATAGACATAGTTTGCAAGG - Intronic
1089668152 11:120033269-120033291 TTGGATGGACAAAGTAGACAGGG - Intergenic
1095967495 12:47878854-47878876 TTCCATGGACATTGTAAGGAAGG + Intronic
1096302671 12:50445219-50445241 TTCCATGGATACAGAATGCAGGG + Intronic
1097095994 12:56548802-56548824 TTCCTGGCACATAATAGGCATGG - Intronic
1099357450 12:81656452-81656474 TTACATGGACATATTGTGCATGG - Intronic
1104079439 12:125417266-125417288 TTCCATGGATATTGTTGGAAAGG - Intronic
1104129836 12:125882796-125882818 TTTCCTGAACATAGAAGGCAAGG + Intergenic
1111595532 13:90404988-90405010 TGCCAAGGACATGCTAGGCATGG - Intergenic
1115419301 14:33174876-33174898 TTCCATGGAGAGAATATGCAAGG + Intronic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1121677811 14:95768642-95768664 TTCTATGGACATATTAGTCAGGG - Intergenic
1125126069 15:36222104-36222126 TTCCATGGAGAGAGGATGCAGGG - Intergenic
1125143141 15:36433316-36433338 TTCAATGCAAATAGTAGGAAAGG - Intergenic
1126995541 15:54439700-54439722 TTCCATGCATATAATATGCAAGG + Intronic
1127389305 15:58492271-58492293 TTCCATGGCCATAGAGAGCATGG - Intronic
1129022270 15:72531767-72531789 TTCCATGAACATAGTATTCTAGG - Intronic
1130734830 15:86537135-86537157 TTACAGGGACTGAGTAGGCATGG + Intronic
1132505700 16:307552-307574 TTCCATGGACAGTGGGGGCAGGG + Intronic
1133466984 16:6036915-6036937 TACCATGACCCTAGTAGGCAAGG + Intronic
1133620992 16:7526209-7526231 TTCCATGGACACAGTGGGGCAGG - Intronic
1139203354 16:65002058-65002080 TTCCCTGGAAATAGGAGGGATGG - Intronic
1139848948 16:69939363-69939385 TTGCATTGACAAAGTTGGCAAGG + Exonic
1140154902 16:72413958-72413980 TGCAATGGGCATAGTAGGGAGGG + Intergenic
1140579253 16:76209662-76209684 TTCCATGTACATTATAAGCATGG + Intergenic
1141099722 16:81188395-81188417 TTCCATGGAAATAGGAGGTGGGG - Intergenic
1144273444 17:13642168-13642190 TTCGATAGATATAGGAGGCAGGG - Intergenic
1144944711 17:18963975-18963997 TTCCATGAACACACCAGGCATGG + Intronic
1152469875 17:80485008-80485030 TTCCTGGCACATAGTAGGCCTGG - Intergenic
1153137552 18:1934052-1934074 GCCCATGGACATAGTGGCCATGG - Intergenic
1153741932 18:8138395-8138417 TTCCAAGGACACAGAAGACAGGG - Intronic
1157098035 18:44704700-44704722 TTCCACACACATAGTAGGCAAGG - Intronic
1159379236 18:67634870-67634892 TTCCATGGGAATAGAAGGCAGGG - Intergenic
1165241486 19:34471986-34472008 TTCCAGGGACTTAGGAGGCTGGG - Intergenic
1166908652 19:46134343-46134365 TTCCATGGACAAAGGAGGAGGGG + Intergenic
1168462696 19:56572772-56572794 TTCCCTGGACATAGTATTCTAGG - Intronic
1202691189 1_KI270712v1_random:96549-96571 TTTCATGGACTCAGTAGGCCTGG + Intergenic
925643090 2:6006147-6006169 TTACATGGAGAGAGTAGGCAGGG + Intergenic
926864494 2:17342916-17342938 TTCCCTTGACATAAGAGGCATGG - Intergenic
927773768 2:25886177-25886199 ATCTATGAACATAGTAGACATGG + Intergenic
930870806 2:56168908-56168930 TCCAATGTAGATAGTAGGCAGGG + Intergenic
931712932 2:65005264-65005286 TTACTGGGAAATAGTAGGCAGGG - Intronic
931853836 2:66281001-66281023 TTCCATGGAAACAGCAGGAAAGG - Intergenic
934461834 2:94216969-94216991 TTTCATGGACTCAGTAGGCCTGG - Intergenic
939651403 2:144767050-144767072 GCCCATTGACATAGGAGGCAAGG + Intergenic
943588054 2:189763524-189763546 TTTCATGTACATAGTAAGGAAGG - Intergenic
943780026 2:191813314-191813336 TTAGATGGACAAAGTAAGCATGG + Intergenic
944302059 2:198134728-198134750 TGCCATGCACGTAGAAGGCAGGG + Intronic
947022377 2:225693969-225693991 TTCCATGGACTTATTATCCAAGG + Intergenic
947610641 2:231522919-231522941 AGCCAGGGACTTAGTAGGCAGGG + Intergenic
1177686522 21:24444134-24444156 TTTCATGGACATAGAAGTAAGGG + Intergenic
1178023766 21:28441087-28441109 TGCCAAGCACATAGTAGGTATGG + Intergenic
1179373458 21:40828352-40828374 TTCCATGGTCACAGTAGCGAAGG + Intronic
1181185731 22:21102383-21102405 TTCCAGGGACACAGTTAGCACGG - Intergenic
1182194232 22:28498037-28498059 TTCCAACGACAGAGTAGCCACGG + Intronic
1184242940 22:43221004-43221026 TTCCAAGGACATTGCAGGCTGGG - Intronic
949125549 3:442293-442315 GTCCATGGACAAAGTGGCCATGG - Intergenic
949344038 3:3060053-3060075 TTCCATGGGCACAGAAGACATGG + Intergenic
951185788 3:19711494-19711516 ATCAATGGGCATAGTAGCCAGGG - Intergenic
954554935 3:51510160-51510182 TAAAATGGACATAGTAGGCCGGG + Intergenic
956445154 3:69318847-69318869 TTCCATGGCAATATTTGGCAAGG + Intronic
957194335 3:77048149-77048171 TTCCTTGTTCATACTAGGCAGGG - Intronic
959857859 3:111181010-111181032 ATCCATGTACATATTTGGCAAGG - Intronic
960277512 3:115744725-115744747 TTCCCTTGACATAAGAGGCATGG - Intergenic
960428248 3:117535904-117535926 TTCCATGGAAATAGCACCCACGG + Intergenic
962061451 3:131932034-131932056 TCCCATGCACATAGCAGTCAGGG + Intronic
962209143 3:133462051-133462073 TTCCATGGACCAGGCAGGCATGG + Intronic
963268027 3:143258442-143258464 TCCCATGAACAAAGTAGCCATGG - Intergenic
963764168 3:149316517-149316539 TTCCTTGGACTGACTAGGCATGG + Intergenic
964953458 3:162325026-162325048 TTCCATTGACATAAGGGGCATGG - Intergenic
965388973 3:168081381-168081403 TTCCATGGACATAGTAGGCAGGG + Intronic
965496114 3:169401216-169401238 TTCCATGGATGCAGTAGACAAGG + Intronic
966843098 3:184105473-184105495 TTTGATGGACATTCTAGGCAAGG - Intronic
966904446 3:184511669-184511691 CTCCATGAACACAGTAAGCACGG - Intronic
966986197 3:185182551-185182573 GCCCATGAACAGAGTAGGCATGG + Intergenic
967243203 3:187461696-187461718 CTCCATGTACAAAGTAGGCAGGG + Intergenic
970539147 4:17059994-17060016 TGCCTGGTACATAGTAGGCATGG - Intergenic
971276912 4:25207248-25207270 TTCCATGGAGATTGTAGGGGAGG - Intronic
972268514 4:37485888-37485910 TTCCCTGAACTTGGTAGGCATGG + Intronic
973576598 4:52296205-52296227 TTCCAGGGACATAATAAGCATGG + Intergenic
978471809 4:109076585-109076607 TTCCATGGACCCAGTGGCCAGGG + Intronic
978623161 4:110654869-110654891 TTCCATGGACAGATTGGGGAGGG + Intergenic
978764587 4:112391124-112391146 TCCCATGGAGATATTAGGCTAGG + Intronic
979773445 4:124558575-124558597 TTCCATAGACAGAGCAGCCAAGG - Intergenic
983776085 4:171609367-171609389 TTCCATGCAAATAGCAAGCATGG - Intergenic
983809204 4:172037447-172037469 TTCCTGTGAAATAGTAGGCATGG - Intronic
989256656 5:39373133-39373155 TTCCAGGGACACAAGAGGCAGGG + Exonic
990491060 5:56303463-56303485 TTCCATGGAAAGGGTGGGCAAGG + Intergenic
991188912 5:63845538-63845560 TTCCATGGCGATAGAAGGCATGG - Intergenic
992981966 5:82184814-82184836 TTCATTAGACAGAGTAGGCATGG - Intronic
993808798 5:92447748-92447770 TTCAATGATAATAGTAGGCAAGG - Intergenic
996401187 5:123064563-123064585 TTCCTTGGACATAGTAATAAAGG + Intergenic
999666329 5:153917058-153917080 TCCCAGGGACAAAGCAGGCAGGG + Intergenic
1001319693 5:170670386-170670408 TTCCAAGGACTTAGAAGTCAGGG + Intronic
1001847109 5:174932120-174932142 TTCCATGGTCATATTTGGAAGGG + Intergenic
1003933689 6:10953965-10953987 TTCCTTGGACATCCCAGGCACGG - Intronic
1006268464 6:32945117-32945139 CACCATGGACATGGTAGACAGGG + Intronic
1009298868 6:61989785-61989807 TTGCATGGAGATAGTAGGGCAGG - Intronic
1010028595 6:71248326-71248348 TTCCATACCCATATTAGGCAAGG + Intergenic
1011481605 6:87799345-87799367 TTCCATGTAGCTAGTAAGCAGGG + Intergenic
1012981811 6:105838853-105838875 TTCCATATATATAGTAGCCATGG + Intergenic
1013778807 6:113707809-113707831 TTCCATGATCTTAGTAGACATGG + Intergenic
1021392858 7:20115789-20115811 TGCCATGAAGATAGTATGCAAGG - Intergenic
1021583707 7:22185238-22185260 TTTAATGGACATAGAAGCCAAGG - Intronic
1022547987 7:31207052-31207074 TTCCATGTACAAAGTGGTCATGG - Intergenic
1023332951 7:39138765-39138787 TTCCATGGACCTGGGGGGCAGGG - Intronic
1023439264 7:40169559-40169581 TTCCCTTGACATAATAGACATGG + Intronic
1023632525 7:42178482-42178504 TTCCTTGGAGATAAGAGGCAAGG - Intronic
1026822042 7:73556624-73556646 TTCCATGAACATTTTAGACACGG + Intronic
1029853998 7:103494907-103494929 CTCAATGCACATAATAGGCATGG + Intronic
1030282138 7:107787865-107787887 TTCCCTGGACAGAGTAGTGATGG - Intronic
1031264592 7:119567493-119567515 TTCCCTTGACATAAGAGGCATGG - Intergenic
1031554960 7:123163147-123163169 TCCCATGGAAATTGTATGCATGG + Intronic
1031868940 7:127071428-127071450 ATCCATGCACAAAGAAGGCAGGG - Intronic
1036153712 8:6322584-6322606 TTGCATGCAAACAGTAGGCAAGG + Intergenic
1044760963 8:95517068-95517090 TTCCTTCGACATAGTAGAGAAGG - Intergenic
1044966081 8:97575321-97575343 TTCCATGAACATCCCAGGCAAGG - Intergenic
1048350181 8:133609614-133609636 TTCCATGGTGCTAGCAGGCATGG + Intergenic
1049030070 8:140028643-140028665 TCCCTGGGACATAGTAGACAGGG - Intronic
1049046201 8:140153962-140153984 TTCCAGGTAAATAGTAGGGAAGG - Intronic
1050184499 9:2958526-2958548 CTAGATGGACAAAGTAGGCATGG - Intergenic
1051734110 9:20180581-20180603 TTCCATGGAGATTATTGGCATGG + Intergenic
1052030962 9:23628476-23628498 TTCCATGGATATAAAAGACACGG - Intergenic
1052033018 9:23649951-23649973 TACCTTGGGCATAGGAGGCATGG + Intergenic
1054303565 9:63393587-63393609 TTTCATGGACTCAGTAGGCCTGG - Intergenic
1054402343 9:64720097-64720119 TTTCATGGACTCAGTAGGCCTGG - Intergenic
1054435946 9:65204412-65204434 TTTCATGGACTCAGTAGGCCTGG - Intergenic
1054494446 9:65817275-65817297 TTTCATGGACTCAGTAGGCCTGG + Intergenic
1058341836 9:103906849-103906871 TTCCATGGAGGTAGTGGGAAAGG - Intergenic
1061273297 9:129556135-129556157 CTCCATAGACATAGCAGCCAGGG - Intergenic
1186787578 X:12968088-12968110 TTCCATGGACAGGGTCGGGAGGG - Intergenic
1191167712 X:57407479-57407501 TTCCATGGACAGGTTAGGTAGGG - Intronic
1193026773 X:76853362-76853384 TCCCATGAACATGGTAGCCATGG + Intergenic
1194906167 X:99578247-99578269 TTCCATGACAATAGAAGGCAGGG - Intergenic
1195680162 X:107539749-107539771 TACCAAGCACATAGTAGACATGG - Intronic
1196577927 X:117342366-117342388 TTCCATAAACATAGTTGGTAAGG - Intergenic
1196872301 X:120124652-120124674 TTCCATGGACTTGGTGGGCGGGG + Intergenic
1198409174 X:136348496-136348518 TTGCATGGTCATAGTAGTCCTGG - Exonic
1199168439 X:144705930-144705952 TTGCATGGAAATTGTAGGTATGG + Intergenic
1199616167 X:149657896-149657918 TTCCCTGGAGAAAGTAGGAAGGG + Intergenic
1199626473 X:149745352-149745374 TTCCCTGGAGAAAGTAGGAAGGG - Intergenic
1201457772 Y:14189244-14189266 TCCCATTGACAGAGCAGGCAGGG - Intergenic
1201721667 Y:17104918-17104940 TTACATGGACATATTATGTAGGG + Intergenic