ID: 965395970

View in Genome Browser
Species Human (GRCh38)
Location 3:168160778-168160800
Sequence ACCTCAGTCCCATGATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965395970_965395977 2 Left 965395970 3:168160778-168160800 CCAGAAAATCATGGGACTGAGGT No data
Right 965395977 3:168160803-168160825 CAAGGGAGCAGATGAGGGCAAGG No data
965395970_965395973 -4 Left 965395970 3:168160778-168160800 CCAGAAAATCATGGGACTGAGGT No data
Right 965395973 3:168160797-168160819 AGGTCCCAAGGGAGCAGATGAGG No data
965395970_965395974 -3 Left 965395970 3:168160778-168160800 CCAGAAAATCATGGGACTGAGGT No data
Right 965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG No data
965395970_965395978 3 Left 965395970 3:168160778-168160800 CCAGAAAATCATGGGACTGAGGT No data
Right 965395978 3:168160804-168160826 AAGGGAGCAGATGAGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965395970 Original CRISPR ACCTCAGTCCCATGATTTTC TGG (reversed) Intergenic
No off target data available for this crispr