ID: 965395974

View in Genome Browser
Species Human (GRCh38)
Location 3:168160798-168160820
Sequence GGTCCCAAGGGAGCAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965395970_965395974 -3 Left 965395970 3:168160778-168160800 CCAGAAAATCATGGGACTGAGGT No data
Right 965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG No data
965395966_965395974 9 Left 965395966 3:168160766-168160788 CCATGCAGGTGTCCAGAAAATCA No data
Right 965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965395974 Original CRISPR GGTCCCAAGGGAGCAGATGA GGG Intergenic
No off target data available for this crispr