ID: 965398922

View in Genome Browser
Species Human (GRCh38)
Location 3:168194765-168194787
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965398922_965398928 19 Left 965398922 3:168194765-168194787 CCACCAGTTTCAGTCCTGCTCAT No data
Right 965398928 3:168194807-168194829 CCAACCACAGTCTCCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965398922 Original CRISPR ATGAGCAGGACTGAAACTGG TGG (reversed) Intergenic
No off target data available for this crispr