ID: 965400357

View in Genome Browser
Species Human (GRCh38)
Location 3:168206026-168206048
Sequence CTGCTGTTCTGGATGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965400357_965400362 7 Left 965400357 3:168206026-168206048 CCCTTTGTCATCCAGAACAGCAG No data
Right 965400362 3:168206056-168206078 ATTGTGCTTCATCCCTTCTGGGG No data
965400357_965400360 5 Left 965400357 3:168206026-168206048 CCCTTTGTCATCCAGAACAGCAG No data
Right 965400360 3:168206054-168206076 TTATTGTGCTTCATCCCTTCTGG No data
965400357_965400361 6 Left 965400357 3:168206026-168206048 CCCTTTGTCATCCAGAACAGCAG No data
Right 965400361 3:168206055-168206077 TATTGTGCTTCATCCCTTCTGGG No data
965400357_965400363 17 Left 965400357 3:168206026-168206048 CCCTTTGTCATCCAGAACAGCAG No data
Right 965400363 3:168206066-168206088 ATCCCTTCTGGGGAAAATTATGG No data
965400357_965400366 30 Left 965400357 3:168206026-168206048 CCCTTTGTCATCCAGAACAGCAG No data
Right 965400366 3:168206079-168206101 AAAATTATGGCATTTTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965400357 Original CRISPR CTGCTGTTCTGGATGACAAA GGG (reversed) Intergenic
No off target data available for this crispr