ID: 965401244

View in Genome Browser
Species Human (GRCh38)
Location 3:168215335-168215357
Sequence CTCTCATAGAAAATAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965401239_965401244 26 Left 965401239 3:168215286-168215308 CCTACATAAAACAGATCATAGTT No data
Right 965401244 3:168215335-168215357 CTCTCATAGAAAATAACCCAGGG No data
965401242_965401244 -3 Left 965401242 3:168215315-168215337 CCAAATAAGGGTTTATTTTGCTC No data
Right 965401244 3:168215335-168215357 CTCTCATAGAAAATAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965401244 Original CRISPR CTCTCATAGAAAATAACCCA GGG Intergenic
No off target data available for this crispr