ID: 965406722

View in Genome Browser
Species Human (GRCh38)
Location 3:168278080-168278102
Sequence GACAGCTACATCTTTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965406719_965406722 10 Left 965406719 3:168278047-168278069 CCTGCATGAATGAAACTGTGGTC No data
Right 965406722 3:168278080-168278102 GACAGCTACATCTTTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965406722 Original CRISPR GACAGCTACATCTTTAAAGT TGG Intergenic
No off target data available for this crispr