ID: 965408825

View in Genome Browser
Species Human (GRCh38)
Location 3:168304167-168304189
Sequence CTCTGGACACTGAGGCTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965408825_965408833 24 Left 965408825 3:168304167-168304189 CCGCTGAGCCTCAGTGTCCAGAG No data
Right 965408833 3:168304214-168304236 GGCAAGATTGGTTGAATCACTGG No data
965408825_965408831 3 Left 965408825 3:168304167-168304189 CCGCTGAGCCTCAGTGTCCAGAG No data
Right 965408831 3:168304193-168304215 TTACTGGGGTTTCATTACATAGG No data
965408825_965408832 12 Left 965408825 3:168304167-168304189 CCGCTGAGCCTCAGTGTCCAGAG No data
Right 965408832 3:168304202-168304224 TTTCATTACATAGGCAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965408825 Original CRISPR CTCTGGACACTGAGGCTCAG CGG (reversed) Intergenic
No off target data available for this crispr