ID: 965410431

View in Genome Browser
Species Human (GRCh38)
Location 3:168323391-168323413
Sequence TATATAGGGTTCAGTACTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 2, 1: 4, 2: 4, 3: 11, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965410431 Original CRISPR TATATAGGGTTCAGTACTAT CGG (reversed) Intergenic
905049158 1:35034301-35034323 TATATAGGGTTTGATACTACTGG + Intergenic
906011439 1:42530866-42530888 TATAGAGGGTTTGGTACCATTGG + Intronic
910046716 1:82926306-82926328 TATATAGAGAACAGTACTTTAGG - Intergenic
914339500 1:146747096-146747118 TATATACGGTTCTTTACTGTTGG - Intergenic
916412659 1:164560888-164560910 TTTATATATTTCAGTACTATAGG + Intronic
916893025 1:169131881-169131903 TATTTAGTGTACAGTACTACAGG + Exonic
919348364 1:196416427-196416449 TATATAGGGTTTGGTACTATCGG + Intronic
922177510 1:223208173-223208195 TAAATAGGGCCCAGTACTAGGGG + Intergenic
1070586840 10:77772815-77772837 TATGTAGGGTCCAGCCCTATGGG + Intergenic
1071209982 10:83329954-83329976 TGTAGAGGGCTTAGTACTATAGG - Intergenic
1073777946 10:106806956-106806978 GATATTGTGTTCAGGACTATGGG - Intronic
1076081381 10:127584697-127584719 AATATAGGATTCACTGCTATTGG - Intergenic
1079863027 11:25697559-25697581 TATAAAGTGTTCAATACAATAGG + Intergenic
1083391487 11:62354364-62354386 GATATAAGGTTGAGTACCATTGG - Intronic
1085089760 11:73701180-73701202 TATATATTTATCAGTACTATAGG - Intronic
1088124540 11:106408229-106408251 TATATAAGGTAGAGTAATATAGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1093229094 12:16521031-16521053 TATATTGGGTGGTGTACTATAGG - Intronic
1094639284 12:32258413-32258435 AATATAGGGTCCAGACCTATGGG + Intronic
1094748955 12:33382606-33382628 AATATAGGCCTTAGTACTATAGG - Intronic
1096434618 12:51578417-51578439 TATATCGGGTTAAGTAGTAATGG - Intergenic
1100824768 12:98464331-98464353 TATATAGGGCTGAGCAATATGGG - Intergenic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1105359026 13:19689449-19689471 TATATAGTCTTAAGTACTTTTGG - Intronic
1107700479 13:43042153-43042175 TATGAAGGGACCAGTACTATAGG - Intronic
1107703908 13:43079845-43079867 TATACAGCTTTCAGTTCTATGGG - Intronic
1109473941 13:62852857-62852879 TATATAGGGTTTGGTACTATTGG - Intergenic
1111911568 13:94318336-94318358 TATATAGGGTTTGGTACTATGGG - Intronic
1113426041 13:110209450-110209472 TAAATAGGATTCAGAACTCTAGG + Intronic
1124446457 15:29738687-29738709 TAAAGAGGTTTCAGTACAATGGG - Intronic
1130557723 15:84934651-84934673 TATACAGGGTTAAGTAAAATCGG - Intronic
1135482921 16:22837445-22837467 TATATAGGGTTTGGTATTATCGG - Intronic
1136222779 16:28839001-28839023 TACATAAGGTTTGGTACTATGGG - Intergenic
1137886072 16:52104943-52104965 TAGATAGGATTCTGGACTATTGG + Intergenic
1138260195 16:55614330-55614352 CATATAGGATACAGTACTCTGGG - Intergenic
1139994783 16:70970312-70970334 TATATACGGTTCTTTACTGTTGG + Intronic
1142393781 16:89819574-89819596 TATGTAGGGTCCAGCCCTATGGG - Intronic
1142772595 17:2109755-2109777 TATATAGGTTTCTCTAGTATAGG - Intronic
1145412918 17:22689124-22689146 AATATTTGGTTCATTACTATAGG + Intergenic
1150829884 17:68510124-68510146 TATATGGTGTTCAGTACAGTGGG - Intergenic
1151016719 17:70562935-70562957 TATATAGGGTTCAGTACCCACGG - Intergenic
1152415568 17:80159276-80159298 TAAATAGGGTTCTAAACTATTGG - Intergenic
1158217267 18:55112975-55112997 TATATAGAATTCGTTACTATTGG - Intergenic
1164954992 19:32375012-32375034 TATATTGGGTTAGGTGCTATTGG + Intronic
1167939180 19:52932576-52932598 CTTATAGGGTCCAGCACTATGGG - Intronic
933489389 2:82966359-82966381 TAGATAGGTTTCTGTACCATGGG - Intergenic
938131906 2:128723838-128723860 TATATAGAGTTAAGTACCAAAGG + Intergenic
938391861 2:130913046-130913068 TATATAGGGTTCGGTACTGGGGG + Intronic
938865979 2:135420857-135420879 TACATATTGTTCAGTTCTATGGG + Intronic
942408139 2:175677159-175677181 TATTTAGAGTTTGGTACTATCGG - Intergenic
943486229 2:188486727-188486749 TATGTAGGGTTCATTAGTTTTGG + Intronic
943913787 2:193602267-193602289 TATATAGAGTTCAGTACTATTGG - Intergenic
946499511 2:220231445-220231467 AATATAGGTTTCAATACTACAGG - Intergenic
1169287801 20:4324194-4324216 TCTATAGGCTTTAGTTCTATGGG - Intergenic
1174496803 20:50950976-50950998 TATATAAGGTTTGGTACTATTGG - Intronic
1177358248 21:20036782-20036804 TATATAGGTATCAGTACAGTGGG + Intergenic
1183817982 22:40319807-40319829 TACTTAGAGTTCGGTACTATTGG + Intronic
949093243 3:54690-54712 TACATAGGGTTCTCTACTATTGG + Intergenic
952286142 3:31971464-31971486 TATAAAGGGTTTAGGACAATGGG - Intronic
953248222 3:41216700-41216722 TATATAGGGTTAAATTATATAGG + Intronic
955324505 3:57999695-57999717 AATATAGGATTCAGCACTGTGGG + Intergenic
955822744 3:62913487-62913509 CACATAGGTTTCAGTCCTATCGG - Intergenic
957033500 3:75270761-75270783 TACATAGGGTTCTGTACTATTGG + Intergenic
965410431 3:168323391-168323413 TATATAGGGTTCAGTACTATCGG - Intergenic
967662481 3:192130103-192130125 TACATGGGGTTTGGTACTATTGG - Intergenic
969266055 4:6064765-6064787 CATCTGGGGTTCAGAACTATAGG + Intronic
969574189 4:8027050-8027072 TATAAAGATGTCAGTACTATGGG + Intronic
972293956 4:37718659-37718681 TATAAAGAGTTCAGTTTTATAGG + Intergenic
977087634 4:92622995-92623017 TAAATAAGGTTCATCACTATTGG + Intronic
978486386 4:109259134-109259156 TATGTAAGGTGCAGTACTAAGGG - Intronic
978542493 4:109833243-109833265 GATATAGGGGTCAGTAGCATTGG + Exonic
979964546 4:127062153-127062175 TATAGAGGGTTTGGTACTATTGG - Intergenic
980039855 4:127926714-127926736 TGTATCAGGTTCAGTGCTATGGG - Intronic
980221940 4:129929228-129929250 TATACAGGATTCGGTACTACAGG + Intergenic
980883260 4:138735199-138735221 TATATAGTTTTCAGTAGTTTGGG + Intergenic
991132673 5:63142372-63142394 TATAGAGGGTTCAGTACTATTGG - Intergenic
992030412 5:72715635-72715657 TATGTATGGTTAAGTAATATTGG + Intergenic
993369708 5:87077279-87077301 AATATAGAATTCAATACTATAGG - Intergenic
994101777 5:95901471-95901493 TATATAGGGTTCGTTACCATCGG - Intronic
998601033 5:143585275-143585297 TTTATATGGATCAGTGCTATTGG - Intergenic
999942156 5:156554664-156554686 TCTAAATGATTCAGTACTATGGG + Intronic
1000821130 5:165984926-165984948 TAGATAGTGTTGAGTAGTATTGG + Intergenic
1015126830 6:129764277-129764299 ACTATAGGGTTCATCACTATAGG - Intergenic
1015988216 6:138907755-138907777 TATATAAGCTTCAGCACTATAGG + Intronic
1017017574 6:150114172-150114194 TATATAGAGCCCAGTATTATCGG - Intergenic
1020843328 7:13249732-13249754 TATATATGGTCAAGTAATATTGG - Intergenic
1023253873 7:38293459-38293481 TCTATAGGGTTAAGTGGTATAGG - Intergenic
1023760577 7:43461892-43461914 TATCTAGGTTTGAGAACTATTGG - Intronic
1026870189 7:73846339-73846361 TATGTAGGGTCCAGCCCTATGGG - Intergenic
1027988028 7:85320179-85320201 TATATACAGTTGAGTGCTATGGG + Intergenic
1037922111 8:22814749-22814771 TATTTAGGGTGTAGTATTATGGG + Intronic
1039026836 8:33267756-33267778 TATACAGGGTTCTGTACCATTGG - Intergenic
1042468858 8:69160458-69160480 TATATTGGGTTAAATACAATAGG - Intergenic
1042933858 8:74039375-74039397 TATGTAGGGTTCAGCCCTAGGGG + Intergenic
1044727042 8:95202434-95202456 TATATAGGGTTCAGTACTCTTGG - Intergenic
1047322438 8:123800221-123800243 TATATAGGGTTGGGTACTACTGG - Intronic
1056147025 9:83742258-83742280 GATACAGGGTTAAGTTCTATTGG + Intronic
1058500965 9:105615739-105615761 TATATAGGGTTCAGTACTATCGG - Intronic
1193721169 X:84989629-84989651 TATTAAGTGTTCAATACTATAGG + Intergenic
1194036352 X:88877644-88877666 TATGTACAGTTCAGTACTAATGG + Intergenic