ID: 965415299

View in Genome Browser
Species Human (GRCh38)
Location 3:168385161-168385183
Sequence AGGGAGAGCGCACTGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965415299_965415308 11 Left 965415299 3:168385161-168385183 CCCCCATTCAGTGCGCTCTCCCT No data
Right 965415308 3:168385195-168385217 ACAGACTCTCTCTGTGCTACAGG No data
965415299_965415312 26 Left 965415299 3:168385161-168385183 CCCCCATTCAGTGCGCTCTCCCT No data
Right 965415312 3:168385210-168385232 GCTACAGGGCTGCTGCTGGGAGG No data
965415299_965415313 29 Left 965415299 3:168385161-168385183 CCCCCATTCAGTGCGCTCTCCCT No data
Right 965415313 3:168385213-168385235 ACAGGGCTGCTGCTGGGAGGTGG No data
965415299_965415314 30 Left 965415299 3:168385161-168385183 CCCCCATTCAGTGCGCTCTCCCT No data
Right 965415314 3:168385214-168385236 CAGGGCTGCTGCTGGGAGGTGGG No data
965415299_965415311 23 Left 965415299 3:168385161-168385183 CCCCCATTCAGTGCGCTCTCCCT No data
Right 965415311 3:168385207-168385229 TGTGCTACAGGGCTGCTGCTGGG No data
965415299_965415309 12 Left 965415299 3:168385161-168385183 CCCCCATTCAGTGCGCTCTCCCT No data
Right 965415309 3:168385196-168385218 CAGACTCTCTCTGTGCTACAGGG No data
965415299_965415310 22 Left 965415299 3:168385161-168385183 CCCCCATTCAGTGCGCTCTCCCT No data
Right 965415310 3:168385206-168385228 CTGTGCTACAGGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965415299 Original CRISPR AGGGAGAGCGCACTGAATGG GGG (reversed) Intergenic
No off target data available for this crispr