ID: 965419137

View in Genome Browser
Species Human (GRCh38)
Location 3:168435513-168435535
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965419133_965419137 -10 Left 965419133 3:168435500-168435522 CCACCACCAGCAGCAGTAACAGC No data
Right 965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr