ID: 965421420

View in Genome Browser
Species Human (GRCh38)
Location 3:168463807-168463829
Sequence ACAATAAAATGGAGCAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965421420_965421427 16 Left 965421420 3:168463807-168463829 CCTTGGTTGCTCCATTTTATTGT No data
Right 965421427 3:168463846-168463868 AAAAGAGAGAGAAGCCAGTAAGG No data
965421420_965421426 -10 Left 965421420 3:168463807-168463829 CCTTGGTTGCTCCATTTTATTGT No data
Right 965421426 3:168463820-168463842 ATTTTATTGTGGGGCATGAAGGG No data
965421420_965421428 19 Left 965421420 3:168463807-168463829 CCTTGGTTGCTCCATTTTATTGT No data
Right 965421428 3:168463849-168463871 AGAGAGAGAAGCCAGTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965421420 Original CRISPR ACAATAAAATGGAGCAACCA AGG (reversed) Intergenic
No off target data available for this crispr