ID: 965421426

View in Genome Browser
Species Human (GRCh38)
Location 3:168463820-168463842
Sequence ATTTTATTGTGGGGCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965421420_965421426 -10 Left 965421420 3:168463807-168463829 CCTTGGTTGCTCCATTTTATTGT No data
Right 965421426 3:168463820-168463842 ATTTTATTGTGGGGCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965421426 Original CRISPR ATTTTATTGTGGGGCATGAA GGG Intergenic
No off target data available for this crispr