ID: 965423244

View in Genome Browser
Species Human (GRCh38)
Location 3:168488681-168488703
Sequence CAGAGTTAGAAATCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965423244_965423245 18 Left 965423244 3:168488681-168488703 CCAGCTTGTGATTTCTAACTCTG No data
Right 965423245 3:168488722-168488744 ATTTTTAAATTTTTTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965423244 Original CRISPR CAGAGTTAGAAATCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr