ID: 965425584

View in Genome Browser
Species Human (GRCh38)
Location 3:168518653-168518675
Sequence CTTTATTAGCAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965425584_965425588 6 Left 965425584 3:168518653-168518675 CCATTCTCATTCTGCTAATAAAG No data
Right 965425588 3:168518682-168518704 CAAGACTGGGTAATTTATAAAGG 0: 1394
1: 2501
2: 4118
3: 3674
4: 2254
965425584_965425585 -8 Left 965425584 3:168518653-168518675 CCATTCTCATTCTGCTAATAAAG No data
Right 965425585 3:168518668-168518690 TAATAAAGACATACCAAGACTGG No data
965425584_965425586 -7 Left 965425584 3:168518653-168518675 CCATTCTCATTCTGCTAATAAAG No data
Right 965425586 3:168518669-168518691 AATAAAGACATACCAAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965425584 Original CRISPR CTTTATTAGCAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr