ID: 965429104

View in Genome Browser
Species Human (GRCh38)
Location 3:168564705-168564727
Sequence CTTTCCAGGGGCACTCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965429100_965429104 9 Left 965429100 3:168564673-168564695 CCAATAAAATGAGTTTCTCTATC No data
Right 965429104 3:168564705-168564727 CTTTCCAGGGGCACTCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965429104 Original CRISPR CTTTCCAGGGGCACTCCATA AGG Intergenic
No off target data available for this crispr