ID: 965433206

View in Genome Browser
Species Human (GRCh38)
Location 3:168614380-168614402
Sequence GCTTGGGCCTCAACTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965433202_965433206 8 Left 965433202 3:168614349-168614371 CCAGGACAGGCAAAGAGACATAA No data
Right 965433206 3:168614380-168614402 GCTTGGGCCTCAACTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965433206 Original CRISPR GCTTGGGCCTCAACTGAAAT TGG Intergenic
No off target data available for this crispr