ID: 965433718

View in Genome Browser
Species Human (GRCh38)
Location 3:168620977-168620999
Sequence CCCAGGACAGGTTTTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965433708_965433718 23 Left 965433708 3:168620931-168620953 CCTCCAACTTATTGATTTGGCTT No data
Right 965433718 3:168620977-168620999 CCCAGGACAGGTTTTCCCAGTGG No data
965433709_965433718 20 Left 965433709 3:168620934-168620956 CCAACTTATTGATTTGGCTTGAT No data
Right 965433718 3:168620977-168620999 CCCAGGACAGGTTTTCCCAGTGG No data
965433706_965433718 30 Left 965433706 3:168620924-168620946 CCAGCAACCTCCAACTTATTGAT No data
Right 965433718 3:168620977-168620999 CCCAGGACAGGTTTTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965433718 Original CRISPR CCCAGGACAGGTTTTCCCAG TGG Intergenic