ID: 965433718 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:168620977-168620999 |
Sequence | CCCAGGACAGGTTTTCCCAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
965433708_965433718 | 23 | Left | 965433708 | 3:168620931-168620953 | CCTCCAACTTATTGATTTGGCTT | No data | ||
Right | 965433718 | 3:168620977-168620999 | CCCAGGACAGGTTTTCCCAGTGG | No data | ||||
965433709_965433718 | 20 | Left | 965433709 | 3:168620934-168620956 | CCAACTTATTGATTTGGCTTGAT | No data | ||
Right | 965433718 | 3:168620977-168620999 | CCCAGGACAGGTTTTCCCAGTGG | No data | ||||
965433706_965433718 | 30 | Left | 965433706 | 3:168620924-168620946 | CCAGCAACCTCCAACTTATTGAT | No data | ||
Right | 965433718 | 3:168620977-168620999 | CCCAGGACAGGTTTTCCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
965433718 | Original CRISPR | CCCAGGACAGGTTTTCCCAG TGG | Intergenic | ||