ID: 965436949

View in Genome Browser
Species Human (GRCh38)
Location 3:168664057-168664079
Sequence CTGCTGTTCTTGATGAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965436946_965436949 27 Left 965436946 3:168664007-168664029 CCCTAATCATTTGGGACACTGGG No data
Right 965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG No data
965436948_965436949 26 Left 965436948 3:168664008-168664030 CCTAATCATTTGGGACACTGGGT No data
Right 965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG No data
965436944_965436949 28 Left 965436944 3:168664006-168664028 CCCCTAATCATTTGGGACACTGG No data
Right 965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965436949 Original CRISPR CTGCTGTTCTTGATGAGACT TGG Intergenic
No off target data available for this crispr