ID: 965439220

View in Genome Browser
Species Human (GRCh38)
Location 3:168692045-168692067
Sequence TCTGATTGGCAGTGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965439210_965439220 23 Left 965439210 3:168691999-168692021 CCATTCCCTCACAAAGGGGTGAG No data
Right 965439220 3:168692045-168692067 TCTGATTGGCAGTGGGGAGAGGG No data
965439209_965439220 24 Left 965439209 3:168691998-168692020 CCCATTCCCTCACAAAGGGGTGA No data
Right 965439220 3:168692045-168692067 TCTGATTGGCAGTGGGGAGAGGG No data
965439213_965439220 18 Left 965439213 3:168692004-168692026 CCCTCACAAAGGGGTGAGGGAAG No data
Right 965439220 3:168692045-168692067 TCTGATTGGCAGTGGGGAGAGGG No data
965439214_965439220 17 Left 965439214 3:168692005-168692027 CCTCACAAAGGGGTGAGGGAAGC No data
Right 965439220 3:168692045-168692067 TCTGATTGGCAGTGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965439220 Original CRISPR TCTGATTGGCAGTGGGGAGA GGG Intergenic
No off target data available for this crispr