ID: 965440452

View in Genome Browser
Species Human (GRCh38)
Location 3:168706648-168706670
Sequence CTCAAAATACAGAGGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965440450_965440452 -9 Left 965440450 3:168706634-168706656 CCAAGACTATTTGACTCAAAATA No data
Right 965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG No data
965440449_965440452 -8 Left 965440449 3:168706633-168706655 CCCAAGACTATTTGACTCAAAAT No data
Right 965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965440452 Original CRISPR CTCAAAATACAGAGGAAGTT TGG Intergenic
No off target data available for this crispr