ID: 965440544

View in Genome Browser
Species Human (GRCh38)
Location 3:168707681-168707703
Sequence GTTACTTGTATTTTTACGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965440544_965440547 27 Left 965440544 3:168707681-168707703 CCCTGCGTAAAAATACAAGTAAC No data
Right 965440547 3:168707731-168707753 TTCATATGAAAAAGACCTAGAGG No data
965440544_965440546 -7 Left 965440544 3:168707681-168707703 CCCTGCGTAAAAATACAAGTAAC No data
Right 965440546 3:168707697-168707719 AAGTAACACATAGAGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965440544 Original CRISPR GTTACTTGTATTTTTACGCA GGG (reversed) Intergenic
No off target data available for this crispr