ID: 965441676

View in Genome Browser
Species Human (GRCh38)
Location 3:168722406-168722428
Sequence ATACATCACCACATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965441671_965441676 22 Left 965441671 3:168722361-168722383 CCATGATTCAAAACTGGATCAGG No data
Right 965441676 3:168722406-168722428 ATACATCACCACATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965441676 Original CRISPR ATACATCACCACATGGAGCT AGG Intergenic
No off target data available for this crispr