ID: 965449978

View in Genome Browser
Species Human (GRCh38)
Location 3:168825754-168825776
Sequence CATTGTCAATGGAGTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965449978_965449982 14 Left 965449978 3:168825754-168825776 CCTTCTCTACTCCATTGACAATG No data
Right 965449982 3:168825791-168825813 GAGAATGTGAGGAAAACTATGGG No data
965449978_965449983 18 Left 965449978 3:168825754-168825776 CCTTCTCTACTCCATTGACAATG No data
Right 965449983 3:168825795-168825817 ATGTGAGGAAAACTATGGGCTGG No data
965449978_965449980 3 Left 965449978 3:168825754-168825776 CCTTCTCTACTCCATTGACAATG No data
Right 965449980 3:168825780-168825802 CACAGTGACTTGAGAATGTGAGG No data
965449978_965449981 13 Left 965449978 3:168825754-168825776 CCTTCTCTACTCCATTGACAATG No data
Right 965449981 3:168825790-168825812 TGAGAATGTGAGGAAAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965449978 Original CRISPR CATTGTCAATGGAGTAGAGA AGG (reversed) Intergenic
No off target data available for this crispr