ID: 965458155

View in Genome Browser
Species Human (GRCh38)
Location 3:168929775-168929797
Sequence CTGTGGCCCCTACGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965458143_965458155 20 Left 965458143 3:168929732-168929754 CCCTTTTCTCTCAGCTTCACTAG No data
Right 965458155 3:168929775-168929797 CTGTGGCCCCTACGGGAAGTGGG No data
965458150_965458155 -10 Left 965458150 3:168929762-168929784 CCCAGCAAGGACTCTGTGGCCCC No data
Right 965458155 3:168929775-168929797 CTGTGGCCCCTACGGGAAGTGGG No data
965458149_965458155 -9 Left 965458149 3:168929761-168929783 CCCCAGCAAGGACTCTGTGGCCC No data
Right 965458155 3:168929775-168929797 CTGTGGCCCCTACGGGAAGTGGG No data
965458144_965458155 19 Left 965458144 3:168929733-168929755 CCTTTTCTCTCAGCTTCACTAGG No data
Right 965458155 3:168929775-168929797 CTGTGGCCCCTACGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965458155 Original CRISPR CTGTGGCCCCTACGGGAAGT GGG Intergenic
No off target data available for this crispr