ID: 965458805

View in Genome Browser
Species Human (GRCh38)
Location 3:168935181-168935203
Sequence AAGAAGCCTGAAGCCCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965458805_965458809 28 Left 965458805 3:168935181-168935203 CCCATGTGGGCTTCAGGCTTCTT No data
Right 965458809 3:168935232-168935254 GAGTGCATAGGAAAAATTCTTGG No data
965458805_965458808 16 Left 965458805 3:168935181-168935203 CCCATGTGGGCTTCAGGCTTCTT No data
Right 965458808 3:168935220-168935242 TATGACAAAGTTGAGTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965458805 Original CRISPR AAGAAGCCTGAAGCCCACAT GGG (reversed) Intergenic
No off target data available for this crispr