ID: 965464155

View in Genome Browser
Species Human (GRCh38)
Location 3:169006189-169006211
Sequence GGTCTGAATAGACCAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965464155_965464158 4 Left 965464155 3:169006189-169006211 CCTGTTATTGGTCTATTCAGACC No data
Right 965464158 3:169006216-169006238 ACTTCTTCCTGGTTTAGTCTTGG 0: 7845
1: 4044
2: 2111
3: 1994
4: 3017
965464155_965464163 12 Left 965464155 3:169006189-169006211 CCTGTTATTGGTCTATTCAGACC No data
Right 965464163 3:169006224-169006246 CTGGTTTAGTCTTGGGAGGGTGG 0: 27
1: 33
2: 29
3: 31
4: 180
965464155_965464164 23 Left 965464155 3:169006189-169006211 CCTGTTATTGGTCTATTCAGACC No data
Right 965464164 3:169006235-169006257 TTGGGAGGGTGGATGTGTCAAGG No data
965464155_965464160 8 Left 965464155 3:169006189-169006211 CCTGTTATTGGTCTATTCAGACC No data
Right 965464160 3:169006220-169006242 CTTCCTGGTTTAGTCTTGGGAGG 0: 4909
1: 3354
2: 2054
3: 1804
4: 2205
965464155_965464161 9 Left 965464155 3:169006189-169006211 CCTGTTATTGGTCTATTCAGACC No data
Right 965464161 3:169006221-169006243 TTCCTGGTTTAGTCTTGGGAGGG 0: 4718
1: 3187
2: 1764
3: 861
4: 576
965464155_965464159 5 Left 965464155 3:169006189-169006211 CCTGTTATTGGTCTATTCAGACC No data
Right 965464159 3:169006217-169006239 CTTCTTCCTGGTTTAGTCTTGGG 0: 8208
1: 3830
2: 1865
3: 1367
4: 1454
965464155_965464156 -7 Left 965464155 3:169006189-169006211 CCTGTTATTGGTCTATTCAGACC No data
Right 965464156 3:169006205-169006227 TCAGACCTTCAACTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965464155 Original CRISPR GGTCTGAATAGACCAATAAC AGG (reversed) Intergenic
No off target data available for this crispr