ID: 965466283

View in Genome Browser
Species Human (GRCh38)
Location 3:169034548-169034570
Sequence CAGCCCTGAGACATTCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965466283_965466287 -8 Left 965466283 3:169034548-169034570 CCTAAGGGAATGTCTCAGGGCTG No data
Right 965466287 3:169034563-169034585 CAGGGCTGAGCAAGGCAGGGTGG No data
965466283_965466288 4 Left 965466283 3:169034548-169034570 CCTAAGGGAATGTCTCAGGGCTG No data
Right 965466288 3:169034575-169034597 AGGCAGGGTGGTACTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965466283 Original CRISPR CAGCCCTGAGACATTCCCTT AGG (reversed) Intergenic
No off target data available for this crispr