ID: 965470559

View in Genome Browser
Species Human (GRCh38)
Location 3:169085153-169085175
Sequence TTTGCCAAACACACCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965470559_965470561 7 Left 965470559 3:169085153-169085175 CCTTCATGGGTGTGTTTGGCAAA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 965470561 3:169085183-169085205 TATTTTTTGTAGAAACCACATGG 0: 1
1: 0
2: 2
3: 67
4: 554
965470559_965470563 19 Left 965470559 3:169085153-169085175 CCTTCATGGGTGTGTTTGGCAAA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 965470563 3:169085195-169085217 AAACCACATGGGATTACTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 101
965470559_965470562 8 Left 965470559 3:169085153-169085175 CCTTCATGGGTGTGTTTGGCAAA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 965470562 3:169085184-169085206 ATTTTTTGTAGAAACCACATGGG 0: 1
1: 0
2: 3
3: 58
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965470559 Original CRISPR TTTGCCAAACACACCCATGA AGG (reversed) Intronic
902731240 1:18370321-18370343 TTTGCCAAAGACCCCCAAGGCGG + Intronic
904362117 1:29982960-29982982 ATTGTAAAACACACCAATGAGGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906263552 1:44411193-44411215 TATGCCAAAGGCACCCATTATGG + Intronic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
909995518 1:82274278-82274300 TTTTGCAAACATACCCGTGAGGG - Intergenic
912169548 1:107081873-107081895 TTTTCCATACAGGCCCATGAGGG + Intergenic
913070674 1:115295553-115295575 TTAGCCAAACACCCAGATGAAGG - Intronic
913544538 1:119853919-119853941 TTTTCCAACCACACACAGGAGGG - Intergenic
913991906 1:143620698-143620720 TTTTCCAACCACACACAAGAGGG - Intergenic
916889965 1:169105649-169105671 ATTGCCAAACCCACCCAGGGCGG - Intergenic
917970893 1:180206786-180206808 TGTGCTAAGCACTCCCATGAAGG - Intergenic
918137433 1:181686820-181686842 TTTTCCAAACACCTCCATGCAGG - Intronic
921809855 1:219500378-219500400 TTTGCCAAACAATCATATGATGG - Intergenic
922506174 1:226127136-226127158 TTTTGAAAACACACACATGAGGG + Intergenic
922852936 1:228749245-228749267 TTTGGAAAACATTCCCATGAGGG + Intergenic
923940538 1:238819557-238819579 TATGCCCTACACACCCATAAAGG + Intergenic
1066003428 10:31125671-31125693 TTTCTCAAACACCCCCAAGATGG + Intergenic
1067356610 10:45534302-45534324 TTTGCCAAACACTGCCGTAAAGG + Intronic
1068572800 10:58649529-58649551 TTTTTAAAAGACACCCATGAGGG - Intronic
1068796739 10:61091235-61091257 TTTGCCAAGCACATCAATGCTGG + Intergenic
1069769758 10:70890732-70890754 TTTGAGATACACACCCATGGGGG - Intergenic
1071457007 10:85858564-85858586 TCTGGAAAACAAACCCATGATGG + Intronic
1071832978 10:89390669-89390691 TGGGCTAAACAAACCCATGAGGG - Intronic
1075420530 10:122297269-122297291 TTTGGCTCACCCACCCATGAAGG - Intronic
1076277060 10:129209760-129209782 ATTGCCAAATGCACCCAGGAAGG - Intergenic
1076631595 10:131855286-131855308 TGTGCCACACACACACAAGACGG + Intergenic
1078376363 11:10796561-10796583 TTTTCCAAAAACACACACGAAGG - Intergenic
1079776407 11:24535692-24535714 TTCCCCAAAGACATCCATGAGGG + Intronic
1083270689 11:61570970-61570992 TTTTCCCAACAGCCCCATGACGG + Intronic
1083588902 11:63880839-63880861 TCTGCAAAAAATACCCATGAGGG - Intronic
1087191579 11:95259667-95259689 TTGGCCAAACTTACCCATGGAGG - Intergenic
1087875487 11:103350883-103350905 TTCTCCAAACACAGCCATAATGG + Intronic
1093043734 12:14416940-14416962 TTTTTCAAACATACCCAAGAGGG - Intronic
1093431955 12:19094532-19094554 TTGACCCAAAACACCCATGATGG - Intergenic
1099159870 12:79227740-79227762 TTTACCAAACAACCCTATGATGG - Intronic
1099517930 12:83622114-83622136 TTTTACACACACACACATGAAGG - Intergenic
1102178742 12:110895547-110895569 TATGCAAAACCCTCCCATGATGG - Intronic
1106525979 13:30541772-30541794 TATACCAAATACACCCATGGTGG - Intronic
1108132680 13:47319981-47320003 ATTGTCAAACATACTCATGATGG + Intergenic
1111696750 13:91633860-91633882 TTTTCCAAAACCACCCATCAGGG - Intronic
1115822120 14:37223800-37223822 TTTGTAAAAAACACCCAGGAGGG - Intronic
1120457035 14:84744837-84744859 ATTGCCAAACATACCCTTGTTGG + Intergenic
1121488986 14:94344287-94344309 TCTGCAAACCACACCCATGAAGG - Intergenic
1121923750 14:97908448-97908470 TGTGCCAAACAAACCCCTAAAGG - Intergenic
1122037612 14:98960244-98960266 TTTGCCAAGGACTCCCCTGACGG - Intergenic
1123141359 14:106082306-106082328 TGTGCCAAAGACACCCATCCTGG + Intergenic
1123166523 14:106330532-106330554 TGTGCCAAAGACACCCATCCTGG + Intergenic
1123167861 14:106343812-106343834 TGTGCCAAAGACACCCATCCTGG + Intergenic
1123169206 14:106355570-106355592 TGTGCCAAAGACACCCATCCTGG + Intergenic
1123170493 14:106368525-106368547 TGTGCCAAAGACACCCATCCTGG + Intergenic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1123192620 14:106585826-106585848 TGTGCCAAACACACACATCCTGG + Intergenic
1123194183 14:106600791-106600813 TGTGCCAAAGACACCCATCCTGG + Intergenic
1126666568 15:51080883-51080905 TATTCCAACCACACCCTTGATGG + Intronic
1127294677 15:57598795-57598817 TGTGCCAAACACACAGATGTCGG - Intronic
1130833033 15:87621137-87621159 TAGGCCAAACTCCCCCATGAGGG - Intergenic
1133058179 16:3157950-3157972 GGTGCCGCACACACCCATGAGGG - Intergenic
1133401831 16:5493581-5493603 TTTTCCATACACACCTATCATGG + Intergenic
1137502012 16:49019081-49019103 TTTACCCAAGACACCCTTGATGG + Intergenic
1140823798 16:78686836-78686858 TTTTCGAAACTCACCCAGGAAGG + Intronic
1143960211 17:10710938-10710960 TTTGCTGGTCACACCCATGATGG + Exonic
1144079714 17:11752859-11752881 CTTGCCAACATCACCCATGATGG + Exonic
1144243073 17:13333420-13333442 TTTGGCAATCTCACCCATGATGG + Intergenic
1146496397 17:33326371-33326393 TTTGACAAACATAACAATGAGGG - Intronic
1146546506 17:33743357-33743379 TTAGCCACACCCACACATGATGG - Intronic
1155393429 18:25361362-25361384 TTTTCCAAAATCACCCATGGTGG + Intergenic
1156510406 18:37631840-37631862 TGTGTCAAACACATCCAAGAAGG - Intergenic
1159002843 18:62988546-62988568 TGTCCCAAACACCCCCATGAGGG + Intergenic
1162755513 19:12856752-12856774 TTAGCCAAACAAACACATGTGGG - Intronic
1164222526 19:23208032-23208054 TTTGTCAAACACACCCTGAATGG - Intergenic
1168523027 19:57067746-57067768 TTTGCCTAACAACCACATGAAGG - Intergenic
925496473 2:4455272-4455294 TTGGCCAAACACCCCAAAGAGGG + Intergenic
928534251 2:32224659-32224681 ATTCTCAAATACACCCATGAAGG + Exonic
928933361 2:36648475-36648497 TTTGCCTTACACCCCCAGGAGGG + Intergenic
930756155 2:54975343-54975365 ATTGCCAGACATACACATGAAGG - Intronic
932693121 2:73930470-73930492 TTTGAGAAACACACCCCTAAAGG + Intronic
934860009 2:97756963-97756985 TTTGCAAAACAGACCCAAGCAGG - Exonic
935634540 2:105239979-105240001 CTTCCCAAACACACCCAGAATGG - Intergenic
938689433 2:133774037-133774059 TTTGCAAAACCCAGCCATTAGGG - Intergenic
942812539 2:180016009-180016031 ATTTCCAAACACCCCCTTGAGGG - Intergenic
943405268 2:187475092-187475114 TTTGACAAAAACACCTATAAAGG + Intronic
1177197828 21:17921392-17921414 TCTGCCCAACACACCCTTGGTGG - Intronic
1178502472 21:33137243-33137265 TTTTTAAAAAACACCCATGAGGG - Intergenic
1179916340 21:44480509-44480531 TCTGCCAACCCCACCCATGGAGG - Intergenic
1184535535 22:45084278-45084300 TCTGCCAAACACCCCACTGAGGG - Intergenic
1184897309 22:47418012-47418034 TTTGCCCAGCAAAGCCATGAGGG + Intergenic
951530701 3:23695515-23695537 TCTGCCAAAGCTACCCATGATGG + Intergenic
952229309 3:31413040-31413062 TTTACCAAACACACTCATCCTGG + Intergenic
953356581 3:42261463-42261485 TGTGCCAAACAAACCCAGGAGGG - Intronic
954945347 3:54419272-54419294 TCTGCCACCCACACCCAGGAGGG - Intronic
959293797 3:104509794-104509816 TTTGCCAAAGTGACCCACGAAGG - Intergenic
962594989 3:136933223-136933245 TTTGGCCAACACACACATAAGGG - Intronic
963505601 3:146180931-146180953 TTTGTTACACACACACATGAGGG + Intergenic
965470559 3:169085153-169085175 TTTGCCAAACACACCCATGAAGG - Intronic
967844534 3:194033279-194033301 TTGGCCAAACACACCCAACCAGG + Intergenic
970171409 4:13294841-13294863 TTTGGCAAACACAGCCTTGGAGG - Intergenic
971987650 4:33846930-33846952 TTTCCCAAGCACCCCCATGCTGG - Intergenic
972694061 4:41427357-41427379 TTTGCCAAGCTCACAAATGATGG + Intronic
975143897 4:70946514-70946536 CTTGCCATACTAACCCATGAAGG - Intronic
983461014 4:168026370-168026392 TGTCCCAAACACAACCGTGAAGG - Intergenic
984919709 4:184752678-184752700 AGTGCCAAAAACACACATGAAGG + Intergenic
985360778 4:189173119-189173141 TCTGCCAAATAGACCCATGTGGG - Intergenic
988678148 5:33455580-33455602 ATTGCTAGACACACCCCTGAAGG - Exonic
989536916 5:42574567-42574589 TTTGCCTTTCACACCCATAATGG - Intronic
992430290 5:76703937-76703959 TCTGGCACACACTCCCATGATGG - Intronic
993353291 5:86876293-86876315 TTTGCACAAGAGACCCATGAAGG - Intergenic
993886251 5:93418906-93418928 TTTATCCAACACACCCAGGAAGG - Intergenic
994050160 5:95353557-95353579 TTTGCAAAACCCAGCCAAGAGGG + Intergenic
994447417 5:99896061-99896083 TTTGCCAATCATACGCAGGATGG + Intergenic
997367603 5:133335851-133335873 TATACCCACCACACCCATGAGGG + Intronic
997883387 5:137610636-137610658 TTTGGCAATAACACCCATGAAGG - Intergenic
999178876 5:149654599-149654621 CTTGCCAACCACAGCCATTAAGG + Intergenic
1000372066 5:160546695-160546717 TTTGCCAAACACAGCTTTCAAGG - Intergenic
1007917736 6:45576745-45576767 TTTCTCACACACATCCATGAGGG - Intronic
1007917827 6:45577371-45577393 TTTCTCACACACATCCATGAGGG - Intronic
1009026643 6:58008016-58008038 TTTGCCAAAACCACCCAGTAAGG + Intergenic
1009202186 6:60759489-60759511 TTTGCCAAAACCACCCAGTAAGG + Intergenic
1009589831 6:65653291-65653313 TTGGTCAAACACACCCAGGATGG + Intronic
1009996533 6:70901477-70901499 TTTGACACACACACCAATGTGGG - Intronic
1010656476 6:78517723-78517745 TTTGCCAGACACACCCAGGGAGG + Intergenic
1012881738 6:104799343-104799365 TTAGGCAAACACACACATAAGGG + Intronic
1022749685 7:33211830-33211852 TTTGCCAGACACACTATTGAAGG + Intronic
1023987060 7:45102917-45102939 TGTGCCAGACAAACCCCTGATGG + Intronic
1029887902 7:103892284-103892306 CTGACCAAAAACACCCATGATGG + Intronic
1032514358 7:132495754-132495776 TTTCCCAAGCTCACCCATGGTGG + Intronic
1033911786 7:146272703-146272725 TTGTCCACACACACACATGAGGG - Intronic
1034024386 7:147683202-147683224 TTTGTCCAACATTCCCATGAAGG + Intronic
1034029887 7:147749149-147749171 TTTGCCAAACACATTTATGGTGG - Intronic
1034891586 7:154844272-154844294 TTTACCAAGGACACCTATGAGGG - Intronic
1035595873 8:857420-857442 TTTGCAAAACACACACCTGATGG + Intergenic
1037020701 8:13966658-13966680 TTTTACAACCACACACATGATGG - Intergenic
1037884514 8:22589233-22589255 TTGGGCCAACACACCCAGGAGGG - Intronic
1040774331 8:51021113-51021135 TCTGCCAAAAAAACCCAAGATGG - Intergenic
1049279978 8:141739312-141739334 TTTTCCAAACAACCCCATGAGGG + Intergenic
1054799633 9:69334581-69334603 TCTGCCAAAGGCAGCCATGAAGG - Intronic
1059459031 9:114418115-114418137 TTAGCCATGCACACCCATGTTGG - Intronic
1061757444 9:132824897-132824919 TTGGCCCAACAATCCCATGAGGG + Intronic
1062072752 9:134566640-134566662 ATTGCCAGACACACACATGCTGG - Intergenic
1188838417 X:34986620-34986642 CTTGACAAAGACACCCAGGAGGG + Intergenic
1190915986 X:54811478-54811500 TTTGCCAACCACACCAAGGGTGG - Intronic
1192547784 X:72027923-72027945 GTTGCCTACCAAACCCATGATGG + Intergenic
1197310324 X:124897081-124897103 TTTTCCTAAAACACCCATGTAGG + Intronic
1197789212 X:130234434-130234456 TTTCCCAAACACACTCAGGGAGG + Intronic
1200144350 X:153918839-153918861 TTTGACTACCACCCCCATGATGG - Exonic