ID: 965472884

View in Genome Browser
Species Human (GRCh38)
Location 3:169116894-169116916
Sequence TTTCACTAGATTCCAAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965472879_965472884 10 Left 965472879 3:169116861-169116883 CCAATCTGGGTGCTCCAAACACA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 965472884 3:169116894-169116916 TTTCACTAGATTCCAAAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 195
965472880_965472884 -4 Left 965472880 3:169116875-169116897 CCAAACACAGAAAACCCCATTTC 0: 1
1: 0
2: 1
3: 21
4: 302
Right 965472884 3:169116894-169116916 TTTCACTAGATTCCAAAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965472884 Original CRISPR TTTCACTAGATTCCAAAGCA AGG Intronic
906911716 1:49959198-49959220 TCTAATTTGATTCCAAAGCATGG + Intronic
908185003 1:61644041-61644063 CTGCCCTAGATTCCAAACCATGG - Intergenic
908588436 1:65601011-65601033 TTTCACTGATTCCCAAAGCAGGG + Intronic
909019313 1:70413627-70413649 TTGCACTAAGTTCCAAAGCTTGG - Intronic
909093231 1:71253375-71253397 TTTCACTATAAGCCAAAGGAGGG - Intergenic
909226790 1:73034800-73034822 TTTGACAAGCTTCCAAAGTAAGG - Intergenic
911804325 1:102186383-102186405 TTTCCCTAATTTCCAAAGCTAGG + Intergenic
913498270 1:119448052-119448074 TTTCACTAGGTTGAAAAACAAGG - Intergenic
913945184 1:125155215-125155237 TTGCACTCGATTCCAAACGATGG + Intergenic
916628495 1:166585927-166585949 TTTCTCTAGAGTCTAGAGCAAGG + Intergenic
918436918 1:184524285-184524307 TTTTTCTAGATTCCAATGAAAGG - Intronic
918492894 1:185101380-185101402 TTTCACTACATATTAAAGCAGGG - Exonic
918601596 1:186369807-186369829 TTTCACTAAGATCCAATGCAAGG - Intronic
918768952 1:188528389-188528411 TTTCACATGATTCAAAATCAAGG + Intergenic
921504069 1:215944856-215944878 TTTCACTAGAATCCATTGGAAGG - Intronic
921541740 1:216424498-216424520 TTTCACTATGTTGCACAGCATGG - Intergenic
922600511 1:226848064-226848086 TTTTACTTGCTTCCAAAACAAGG + Intergenic
924031241 1:239887940-239887962 TTTCAATATATTACAAATCAGGG - Intronic
924403373 1:243714288-243714310 TTTTACTAGATTGCAGTGCAAGG - Intronic
1064497856 10:15933373-15933395 TTTCACTAGAATTCAGTGCAAGG + Intergenic
1066590391 10:36988214-36988236 TTTCACTAGATGCCATTCCAGGG - Intergenic
1068197176 10:53731974-53731996 TTTGCCTAAATTCCAAAGCGAGG + Intergenic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1068888887 10:62127648-62127670 TCTCACAAGAATCCAAAGCCAGG + Intergenic
1070671196 10:78378419-78378441 TGTGACTAGATGACAAAGCAAGG - Intergenic
1071084127 10:81848367-81848389 TTACACTAGATTCCCAAGAATGG - Intergenic
1071882442 10:89914159-89914181 ATTCACTACATTACAAAGAATGG - Intergenic
1072056144 10:91758281-91758303 ATTCAATACAGTCCAAAGCAAGG + Intergenic
1072243435 10:93519347-93519369 TTTTAGTATATTCCAAACCAGGG + Intronic
1072424604 10:95319455-95319477 TTTTCCTTGATGCCAAAGCAAGG - Intronic
1073564579 10:104524221-104524243 TTTCACTATATCCCATGGCAAGG - Intergenic
1074047998 10:109856881-109856903 TTGCACTAGATTCTAAAGATGGG + Intergenic
1074383364 10:112997879-112997901 TGTCACTGGATTACAATGCAAGG - Intronic
1078984855 11:16583763-16583785 TTTGACTAGATACCAAACAATGG + Intronic
1080796595 11:35569487-35569509 ATTCACTTGATTCCAAATCTTGG - Intergenic
1082285648 11:50315343-50315365 TTTTAGTACAATCCAAAGCAAGG - Intergenic
1087742103 11:101899619-101899641 ATTCACTATACTCCAGAGCATGG + Intronic
1088888678 11:114027929-114027951 TTTCAGTATATGCCACAGCAGGG - Intergenic
1089784161 11:120896054-120896076 TTTCCCTCGCTTCCAAAGCCAGG + Intronic
1091250992 11:134144142-134144164 TAGCACTAGATGCCACAGCAAGG - Intronic
1094461239 12:30698528-30698550 TTCCACTTCATTCCAAAGAATGG + Intergenic
1097624915 12:61988321-61988343 ATTCTCTAGATTCCAAATCTTGG - Intronic
1101043555 12:100781487-100781509 TATAACCAGAATCCAAAGCAGGG - Intronic
1103281160 12:119759115-119759137 TTGCTCTAGACTCCACAGCAGGG + Intronic
1103739307 12:123080693-123080715 TTTCATTTGATCTCAAAGCATGG - Intronic
1104611554 12:130232837-130232859 TTTCAGTAGAATCCTAACCACGG + Intergenic
1109251578 13:60027254-60027276 TTACACTAAATTACAGAGCAAGG + Intronic
1111468677 13:88648209-88648231 TCTCCCTAGAATCCAAAGAATGG + Intergenic
1113134735 13:107076776-107076798 TTTCAATAGAACCCAAAGTATGG + Intergenic
1113213910 13:108015687-108015709 CTTCTGTATATTCCAAAGCATGG - Intergenic
1113221007 13:108102565-108102587 TCTCACTAGATTCCAATAAAAGG + Intergenic
1115756014 14:36526295-36526317 TTTGACCAGAGTCCAAAGAAGGG - Intergenic
1117322673 14:54639017-54639039 TCTCACTAGATGCCTGAGCAAGG + Intronic
1121056075 14:90854570-90854592 CAACACTAGATTCCACAGCAAGG + Exonic
1121529569 14:94643036-94643058 TTGCCCTAGATTTCAAAGCCAGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1124986458 15:34620948-34620970 TTTCACTTGATTTCAATGCTGGG - Intergenic
1125230720 15:37452378-37452400 TTTCACCAGTTTCTAGAGCAGGG - Intergenic
1125396554 15:39255006-39255028 CTTCACTAGTTTTCAAACCAAGG + Intergenic
1126356896 15:47805641-47805663 TTTCAATAAGTTGCAAAGCAAGG - Intergenic
1127610034 15:60627594-60627616 GTTGACTAAATTCCAAAGCTGGG + Intronic
1127694014 15:61426373-61426395 TATCACTTCATTCCAAAGCTGGG + Intergenic
1128610380 15:69068191-69068213 TTTCACTATGTACCAAATCATGG - Intergenic
1129141567 15:73602886-73602908 TATCACTAGCTTCTAAACCAGGG + Intronic
1129571576 15:76690957-76690979 TTCCACTGGAATCAAAAGCAAGG + Intronic
1130849026 15:87776019-87776041 CTTCATTAAATCCCAAAGCATGG + Intergenic
1138289381 16:55833680-55833702 ACTCACTACTTTCCAAAGCAGGG + Intergenic
1140759580 16:78099225-78099247 TTTCACGAGACCCCAAGGCAAGG + Intergenic
1143709612 17:8725321-8725343 TTTCCCTAGCTTCCAGACCAGGG - Intergenic
1147793874 17:43029120-43029142 ATGCACTAAATTCAAAAGCAAGG + Exonic
1150222218 17:63502277-63502299 TTTTAGTAGAGGCCAAAGCACGG + Intronic
1151505609 17:74525142-74525164 TATCAGTAGAGTCCAAGGCATGG + Intronic
1156620249 18:38843147-38843169 TTTGAGGAGTTTCCAAAGCAAGG + Intergenic
1156878111 18:42041259-42041281 TTGCATTATATTCCAAAGTATGG + Intronic
1158818119 18:61127349-61127371 GTTTACAAGATTCCAAATCAGGG + Intergenic
1160272694 18:77402269-77402291 TTTCTCTAGAGACCAAAACAAGG + Intergenic
1164296660 19:23916133-23916155 TTTCACAAGTGTCCCAAGCAGGG + Intronic
1166424028 19:42660081-42660103 TTTCTCTAGATACCAAAATAAGG - Intronic
925114562 2:1367597-1367619 TGTCACTAGTTTCCAAAGACGGG + Exonic
926916287 2:17895135-17895157 TTTCACTACCTTCCAAAGAATGG + Intronic
927083110 2:19649855-19649877 TTGCTCTAGATTCAAAAGAAAGG - Intergenic
929972727 2:46597249-46597271 TTTCAATAGATTCCTGAGAAAGG + Intronic
931041897 2:58310318-58310340 TTTAATGAGATTCCTAAGCAGGG + Intergenic
933195472 2:79384431-79384453 TCTCACTTTATTCCAAAGTAAGG + Intronic
935516474 2:104046778-104046800 TTTCAACAGAGTTCAAAGCAGGG - Intergenic
935597771 2:104892993-104893015 TTTCACTAGATTCGAATGGCAGG + Intergenic
938079504 2:128362148-128362170 TTTAACTAGACTCCAGTGCACGG + Intergenic
942468608 2:176235227-176235249 TTTCCCCAGATTTCAAAACAAGG - Intergenic
942537667 2:176982482-176982504 TTTCCCTACAGTCCAGAGCAGGG + Intergenic
943013886 2:182487401-182487423 TTTGAGTAGATTCCTAAGAATGG - Intronic
943932736 2:193875933-193875955 ATTCACTGAATTCCAAAGAATGG - Intergenic
945363073 2:208915395-208915417 CTTCATCAAATTCCAAAGCATGG - Intergenic
947179394 2:227398848-227398870 TTTCTCTGTATTCTAAAGCAGGG + Intergenic
1171285747 20:23936961-23936983 TTTCACTAGAGTGCAGGGCAGGG + Intergenic
1171947234 20:31389500-31389522 CTTCAGTTGATTCCAAAGTAAGG - Intronic
1172347778 20:34217530-34217552 TTTCAGTAGATTCCCAGCCAGGG - Intronic
1175132394 20:56799229-56799251 TTTAACTGGATTTTAAAGCAAGG + Intergenic
1176450089 21:6854660-6854682 TTTTTCTAGCTTCAAAAGCATGG + Intergenic
1176828258 21:13719678-13719700 TTTTTCTAGCTTCAAAAGCATGG + Intergenic
1178080538 21:29059130-29059152 TTTCACTAGTTCTCAAAGTATGG - Intronic
1179213953 21:39349911-39349933 TTTCACTATGTTGCACAGCATGG + Intergenic
1182075111 22:27490254-27490276 CTTGCCTAGATTCCCAAGCAAGG - Intergenic
951579246 3:24144349-24144371 TCTTTCTAGATTCCAAAGCCTGG - Intronic
952329178 3:32348063-32348085 CTTCAGTAGATTCCTAAGAAAGG + Intronic
952741444 3:36738390-36738412 TTTCACTAGATGACAGAGCGAGG - Exonic
953829947 3:46287774-46287796 TTTCAATAGTTTCGAAAGCAAGG + Intergenic
953830263 3:46291202-46291224 TTTCACTTTATTACAAATCATGG + Intergenic
955521701 3:59781555-59781577 TTTCACTATAATTCAAAGAAAGG + Intronic
955561913 3:60200586-60200608 TGTCCCTAGAGTTCAAAGCATGG - Intronic
957186429 3:76947409-76947431 TTTCACTAGATAGTAAATCAAGG - Intronic
957741484 3:84275777-84275799 TTTCACTAGATGCCAGGGAAGGG + Intergenic
958158299 3:89784424-89784446 TTTCTCTAGATTCCAAAATGAGG + Intergenic
958516141 3:95118331-95118353 TTTCCCTACATTCAAAAACAAGG - Intergenic
959022565 3:101204393-101204415 CTTCACTACATTCCAGAACAGGG - Intergenic
960467875 3:118019731-118019753 ATTCTCTAGATTCCAAGGGAGGG + Intergenic
960756968 3:121025022-121025044 ATTCCCCAAATTCCAAAGCAAGG + Intronic
964042672 3:152281479-152281501 TTTCACTAGCTTTGAAAGGAGGG + Intronic
964316837 3:155454273-155454295 TTTCATTAGATTCCAAATCAGGG - Intronic
964897451 3:161614789-161614811 TTTCATTAGATTTCAAAGCCAGG + Intergenic
965472884 3:169116894-169116916 TTTCACTAGATTCCAAAGCAAGG + Intronic
969158264 4:5232496-5232518 TTTCACTAAATTCCAAGTTAAGG + Intronic
971139337 4:23906772-23906794 TTTGACTACATTTCCAAGCAGGG - Intergenic
971599931 4:28580006-28580028 TTTCAAAAGATTTCAAAGAATGG + Intergenic
972090812 4:35280685-35280707 TTTAACAAGATTAAAAAGCATGG + Intergenic
975373276 4:73612921-73612943 TTTCATTAGATTACAAGGCCTGG - Intronic
976074471 4:81281636-81281658 TTTGACTACATTATAAAGCAAGG + Intergenic
978736098 4:112086309-112086331 TTTCCCTTGAGTCCAAAGAAAGG + Intergenic
979208237 4:118068508-118068530 TTTCATGAGTTTCCAAACCACGG + Intronic
979835808 4:125365983-125366005 TCCCACGAGAATCCAAAGCAGGG - Intronic
981779877 4:148416534-148416556 TGTAACTTGATTCCAGAGCATGG - Intronic
982859182 4:160427627-160427649 ATCCACTAGATTCCCAAGAAGGG - Intergenic
983086249 4:163448277-163448299 TTTCAAGATATTCCAAGGCATGG - Intergenic
984031241 4:174606513-174606535 TTTTACTTGTTTCCAAAACAAGG + Intergenic
984516166 4:180742999-180743021 TTTTACTAGATTCCACAGAATGG + Intergenic
984620126 4:181943270-181943292 TTTAAGTAGTTTCCAAGGCAAGG - Intergenic
986868932 5:12024631-12024653 CTTCATTAGATTTCAAATCATGG - Intergenic
987059779 5:14231493-14231515 TTCAACTTGATTCCAAAGAAAGG - Intronic
988259612 5:28867954-28867976 TTTCTCTAGATAGGAAAGCATGG - Intergenic
988368328 5:30332551-30332573 TTTCATTATATTCCTAATCAGGG - Intergenic
988540481 5:32104085-32104107 TCTCACTAGTTTCCAAAGGTGGG - Intronic
989758408 5:44984252-44984274 TTTCATTAGATTCTAAGGCTAGG + Intergenic
990606035 5:57411002-57411024 TATCACTATATTCCAAAGAGAGG - Intergenic
991233719 5:64368147-64368169 TTTCCATAGAGTTCAAAGCATGG - Intronic
991948418 5:71924493-71924515 CTTCACTAGAGGCCAAAGAAAGG - Intergenic
995896079 5:117012428-117012450 TTTCATCAAATCCCAAAGCACGG + Intergenic
996121597 5:119679875-119679897 TTTCATTATATTTTAAAGCATGG + Intergenic
997670066 5:135663557-135663579 TATCACTATATTACAAATCAGGG - Intergenic
999364959 5:151016914-151016936 TTTCTCTCGATTGCAAAACAAGG + Intergenic
999515642 5:152298996-152299018 TTTCACTAGATTCAAACTTAGGG - Intergenic
1000923564 5:167166959-167166981 TGGCACCAGGTTCCAAAGCATGG - Intergenic
1002839085 6:890413-890435 TTGTTCTAGATTCTAAAGCATGG + Intergenic
1003196865 6:3922184-3922206 TTTCTCTAGATTCAAAAATATGG - Intergenic
1005510308 6:26506604-26506626 TTTCTCCACATTCCAAAGGAGGG - Intronic
1008778412 6:55069910-55069932 TTGCATTTGATTCTAAAGCAGGG + Intergenic
1009477673 6:64114720-64114742 TTTCCATAGATTTCACAGCAAGG + Intronic
1010337211 6:74700745-74700767 TTCTAATAGATTCCAAAACATGG + Intergenic
1011363931 6:86559556-86559578 TCTCATTAGATTAAAAAGCAGGG + Intergenic
1011701945 6:89963713-89963735 TTTCAAAAGAATCCAAAGCAGGG + Intronic
1013149300 6:107428630-107428652 TTTCACTATATTGCCAAGGATGG - Intronic
1013958903 6:115873949-115873971 TTCCACTAGATTCCTTAGAAAGG - Intergenic
1014417609 6:121202434-121202456 ATTCACTAGATTCATTAGCATGG + Intronic
1014838402 6:126186354-126186376 TTTTTATAGATCCCAAAGCAAGG - Intergenic
1014997763 6:128172858-128172880 TATCAATATATTCCAAAGAATGG + Intronic
1015567203 6:134585891-134585913 TTTCAGAGGACTCCAAAGCAGGG - Intergenic
1016353832 6:143195940-143195962 TTTTACTTGATCCCGAAGCAAGG + Intronic
1019682333 7:2357955-2357977 TTTGACTAGTTTCCATAGCAGGG + Intronic
1021037553 7:15818672-15818694 TGTCACTAGATTCAAAAGCTAGG - Intergenic
1022595711 7:31711884-31711906 TGTCACTGGAATCCAAAGCAGGG - Intergenic
1023154664 7:37236749-37236771 TTTTATTACATTCCAAATCAAGG + Intronic
1024459352 7:49644093-49644115 TTTCAGTAAATTACAAAGCATGG + Intergenic
1025836444 7:65098558-65098580 TTTTAGTACAATCCAAAGCAAGG - Intergenic
1025906215 7:65788006-65788028 TTTTAGTACAATCCAAAGCAAGG - Intergenic
1028678975 7:93503454-93503476 TTGCACAAGTTTCCACAGCAAGG + Intronic
1031699887 7:124911567-124911589 CTTCCCTAAATTCTAAAGCAAGG + Intronic
1036468820 8:9030807-9030829 TTTCAGTCTATTTCAAAGCATGG - Exonic
1037103332 8:15074723-15074745 TGTCAATAGATGACAAAGCATGG - Intronic
1039373218 8:37007888-37007910 TTACATTACAATCCAAAGCATGG - Intergenic
1040321362 8:46307847-46307869 TTTCTTTTGATTCCAAAGAATGG - Intergenic
1041980259 8:63849657-63849679 TCTCCTTAGATTCCAAGGCACGG + Intergenic
1042724802 8:71861937-71861959 CTTCACTACTTTCCAGAGCAAGG + Intronic
1043753678 8:83973745-83973767 TTTTCTTTGATTCCAAAGCAAGG - Intergenic
1044309178 8:90673828-90673850 TTTTACTATATTCTGAAGCAAGG - Intronic
1045382587 8:101642165-101642187 TTTCATTTGTTTTCAAAGCAAGG - Intronic
1045890783 8:107154600-107154622 GTTCAATACATTCCAAAGAAGGG + Intergenic
1046185803 8:110715092-110715114 TTCCACGAGATTCAAAAGCATGG + Intergenic
1046755944 8:117972988-117973010 TTTCACTAGAAACCAAAGAAAGG + Intronic
1047190867 8:122677917-122677939 TTTCCCTGGAGTCCAAAGGAAGG - Intergenic
1050833022 9:10037491-10037513 TTCCACAATATACCAAAGCATGG - Intronic
1052279121 9:26712879-26712901 TTTCAATATACTCCAAGGCAGGG + Intergenic
1052584181 9:30403325-30403347 TTTGAGTAGTTTGCAAAGCAGGG + Intergenic
1053100934 9:35371826-35371848 CTTCCCTATAGTCCAAAGCAGGG - Intronic
1057421350 9:94915557-94915579 GTCAACTAGATTTCAAAGCAAGG - Intronic
1058035355 9:100246486-100246508 TTTAATTTGATTCAAAAGCAAGG + Intronic
1060119191 9:120972379-120972401 TTTCATTAGAACCCAGAGCAGGG + Intronic
1061458568 9:130717505-130717527 TCTCACTAGATTGCACAGCTGGG - Intronic
1203519093 Un_GL000213v1:29857-29879 TTTTTCTAGCTTCAAAAGCATGG - Intergenic
1186248533 X:7640760-7640782 TTTCATGAGATTCCAAGGGAGGG + Intergenic
1186649757 X:11546457-11546479 TTTCAGAAGGTTGCAAAGCAAGG + Intronic
1186650016 X:11549141-11549163 TTTCAGAAGGTTGCAAAGCAAGG + Intronic
1188580555 X:31707126-31707148 TTTCATTAGGTTCCAAATAACGG - Intronic
1189838601 X:45046367-45046389 TTTCACTAGAATCAGGAGCAAGG + Intronic
1190786103 X:53650646-53650668 TTTCAATAGATACCAAATCTGGG + Intronic
1191041773 X:56089297-56089319 TTTTACTAATTTCCCAAGCAGGG + Intergenic
1193862279 X:86684395-86684417 ATTCATTAGCTTCTAAAGCATGG + Intronic
1197299876 X:124765008-124765030 TTTCTTTAGATTTCAAAGAATGG - Intronic
1197463062 X:126767205-126767227 TTTGAGTAGATTAAAAAGCAAGG - Intergenic
1197692536 X:129518470-129518492 TGTCACCAAATTGCAAAGCAAGG + Intronic
1198408108 X:136336619-136336641 ATTCACTAGAGTACAGAGCAAGG - Intronic
1198591866 X:138192342-138192364 TTTCAATAGATTCCCAAACTTGG - Intergenic