ID: 965473178

View in Genome Browser
Species Human (GRCh38)
Location 3:169120768-169120790
Sequence TTAAATCCTACAACCTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965473175_965473178 18 Left 965473175 3:169120727-169120749 CCATGAACATTTACAATATGAGA 0: 1
1: 0
2: 1
3: 18
4: 262
Right 965473178 3:169120768-169120790 TTAAATCCTACAACCTGTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965473178 Original CRISPR TTAAATCCTACAACCTGTGG AGG Intronic
902993064 1:20203183-20203205 TTAATTCCTACAACCCTGGGAGG - Intergenic
906750375 1:48253306-48253328 TTAAATCCTACAACTCTTAGAGG + Intergenic
909261373 1:73493323-73493345 TTAAATGCTACAATCTGTGATGG + Intergenic
912412386 1:109487908-109487930 CTATACCCTACAACCTGTGATGG - Intronic
915832548 1:159144814-159144836 TTAAATCCTACATCCTACTGTGG + Intronic
918975333 1:191476690-191476712 TTAAATCCTGCATTGTGTGGGGG - Intergenic
923141581 1:231164255-231164277 ATAAATCCTAAAACCTCGGGTGG - Intronic
1063945234 10:11169625-11169647 TTAAATCCTTCAGCCTGGGAAGG - Intronic
1064487497 10:15810064-15810086 TTTAATCCTACAAAATGTGTTGG + Intronic
1068948398 10:62752875-62752897 TGAAAGCCTCCAACATGTGGGGG + Intergenic
1070089818 10:73273354-73273376 TTAAATGCAACATCATGTGGTGG + Intronic
1071325281 10:84509696-84509718 TTTAATCCTGAAACTTGTGGAGG - Intronic
1073014675 10:100388454-100388476 TGAAATCCTTCTCCCTGTGGTGG + Intergenic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1079655981 11:22987369-22987391 ACAAACCCCACAACCTGTGGAGG - Intergenic
1080677039 11:34438003-34438025 ATAAATCCTAGCACCTGAGGAGG + Intergenic
1083067957 11:59945345-59945367 TTAAATGGTACAACCAGTGATGG + Intergenic
1086150825 11:83608889-83608911 TAAAATCCAACAAACTATGGTGG + Intronic
1089636669 11:119818532-119818554 ATAAATGGTACAATCTGTGGGGG - Intergenic
1089979878 11:122763478-122763500 TGAAGGCCTCCAACCTGTGGGGG - Intronic
1097649901 12:62284367-62284389 TTAAATTCCACAATGTGTGGGGG + Intronic
1097830399 12:64218290-64218312 ATAAAACCTAAAAGCTGTGGAGG + Intronic
1102047543 12:109839442-109839464 TTAATCCCTACAACCTGAAGAGG - Intergenic
1103861642 12:124019797-124019819 TTACATCCTTCCACCTTTGGTGG + Intronic
1104468469 12:129008843-129008865 TTAATCCCTGGAACCTGTGGAGG - Intergenic
1109385313 13:61622654-61622676 TTAAGGCCTACAACCTCAGGAGG - Intergenic
1119554622 14:75543464-75543486 TTAAACCCCACATCCTGGGGGGG - Intronic
1123426592 15:20176098-20176120 TTAAAAACCACAACCAGTGGAGG - Intergenic
1123535823 15:21182625-21182647 TTAAAAACCACAACCAGTGGAGG - Intergenic
1127258163 15:57308332-57308354 TTGAATCCCCCAAGCTGTGGTGG - Intergenic
1129509378 15:76109374-76109396 ATAAATCCTACAGCCTTGGGAGG - Intronic
1131308418 15:91266187-91266209 TTAAACCCTAAAAACAGTGGGGG - Intronic
1135826502 16:25733541-25733563 TTTAATCCTGCAACCTGTACTGG - Intronic
1138140104 16:54560550-54560572 GTCCCTCCTACAACCTGTGGGGG - Intergenic
1146893153 17:36521667-36521689 TTAATACCTAAAACCTTTGGGGG + Intronic
1147623835 17:41886295-41886317 TTGATGCCTCCAACCTGTGGGGG + Exonic
1148976430 17:51533884-51533906 TTGAATGCTACATCCTCTGGAGG - Intergenic
1153054363 18:931257-931279 TGTAATCCTACCACCTGGGGAGG - Intergenic
1154486015 18:14871634-14871656 GTAAATCCTAGCACCTGGGGAGG + Intergenic
1156066282 18:33147263-33147285 TTAAATGCTGCATCCTCTGGAGG + Intronic
1158230911 18:55254128-55254150 TGGAATCATACAACATGTGGTGG - Intronic
1159557544 18:69961204-69961226 TTAAATCCTACAAATTCTTGAGG - Intronic
1159797770 18:72865722-72865744 ACAAATCCTACAGACTGTGGAGG + Intronic
1163309403 19:16504211-16504233 TTAAACCCAAAAACCTGTTGGGG + Intronic
930167995 2:48222233-48222255 TGTAATCCTAAAACCTGGGGAGG + Intergenic
930971513 2:57400406-57400428 TTTAAACGTACAAGCTGTGGTGG + Intergenic
933305691 2:80595664-80595686 TTAAAGCTAAAAACCTGTGGTGG + Intronic
933779612 2:85792352-85792374 TTCAATCCCAGAACCTGGGGCGG + Intergenic
935624943 2:105164193-105164215 TTTAGCCATACAACCTGTGGTGG + Intergenic
935861414 2:107334657-107334679 TTATTTCATACAACCTGTGGTGG - Intergenic
942872797 2:180755702-180755724 TTAAGGCCTACAACCTATGGAGG - Intergenic
943620102 2:190139704-190139726 TTACCTCCCACAACATGTGGAGG + Intronic
947699202 2:232218362-232218384 TTGAATCCTACAAAGTCTGGAGG + Intronic
1169577249 20:6978551-6978573 CTAAATCCTACAAGATGTGTGGG - Intergenic
1170026363 20:11892383-11892405 TTAAAGCCAGTAACCTGTGGGGG - Intronic
1172539591 20:35700647-35700669 TTATATCTTACTACCTGGGGTGG - Intronic
1174434487 20:50496158-50496180 TTAACTCTTACTACCTGTGCTGG - Intergenic
1177815088 21:25967882-25967904 TTAACTTCTACCACCTTTGGAGG - Intronic
1179388831 21:40969070-40969092 GAAAATCCTACAATCTGTGGAGG - Intergenic
1181751186 22:24990345-24990367 TTTAATCCTACCACTTCTGGAGG - Intronic
1182527751 22:30932104-30932126 TCAACTCCTAGCACCTGTGGTGG + Intronic
949494301 3:4617378-4617400 TCAAATACTGCATCCTGTGGAGG + Intronic
950529898 3:13547173-13547195 TTGAATCCTTCCTCCTGTGGGGG - Intergenic
951852906 3:27162946-27162968 TTAGAGCCTAAAAACTGTGGTGG - Intronic
954408394 3:50358355-50358377 TGAGATCCTGCAGCCTGTGGTGG - Exonic
956455608 3:69417832-69417854 TTCACCCCTACAACCTCTGGAGG - Intronic
964070563 3:152627222-152627244 TTTAATGCTAAAAGCTGTGGAGG - Intergenic
964556033 3:157939775-157939797 TTAAAGCACACAACTTGTGGAGG + Intergenic
965112247 3:164442554-164442576 TTAAATCATACAAGCTTTAGGGG - Intergenic
965473178 3:169120768-169120790 TTAAATCCTACAACCTGTGGAGG + Intronic
972447539 4:39159841-39159863 TTAAATCATAGAATCTGTGTAGG - Intergenic
972539654 4:40028359-40028381 CTAAATCCTGGAAGCTGTGGAGG + Intergenic
974379809 4:61124748-61124770 TTAAATCATACAACATGGGAAGG - Intergenic
978875438 4:113635360-113635382 TAAAATCCTACAATTTGTGTGGG + Intronic
979955473 4:126948763-126948785 GGAAATCCTACAAGTTGTGGAGG + Intergenic
981398530 4:144283651-144283673 TTAAAGTCTTCAGCCTGTGGTGG + Intergenic
983171166 4:164538218-164538240 TCAAATCCTTTCACCTGTGGTGG + Intergenic
988817062 5:34844897-34844919 TTAAAAGCTTCAACATGTGGTGG - Intronic
990590576 5:57258811-57258833 TTAAAAGCTACAGCCTCTGGTGG + Intronic
992413505 5:76531168-76531190 TTAAATGCTGCATCCTCTGGAGG + Intronic
992586592 5:78246214-78246236 TTTCATCCTTCAACCTTTGGTGG + Intronic
995344880 5:111101141-111101163 TTATATCTCACTACCTGTGGGGG - Intronic
996613441 5:125411797-125411819 TTAATTACTAAAACCTGAGGAGG - Intergenic
997851918 5:137340519-137340541 TTAATTCTTACAACCTGGTGAGG - Intronic
1000291390 5:159874696-159874718 TTAAATTAAACAACCTGTGTGGG + Intergenic
1003856008 6:10276218-10276240 TCAATTCCTCCAATCTGTGGAGG - Intergenic
1005010929 6:21334867-21334889 TTAACACCTACAAAGTGTGGTGG + Intergenic
1006212291 6:32406755-32406777 TTTAATCCTAAAGCCTGTGCTGG + Intronic
1013367099 6:109444785-109444807 TCAATTCCTGCACCCTGTGGAGG + Exonic
1015747710 6:136527869-136527891 TTAAATCAAGCAGCCTGTGGAGG - Intronic
1015902613 6:138083333-138083355 TTAAATGCTACAACCTGGGATGG + Intergenic
1016076307 6:139800473-139800495 TTAAATATTAAAACATGTGGTGG + Intergenic
1016285282 6:142465751-142465773 TTAAATCCTACAACCTGAGCTGG + Intergenic
1018526111 6:164711104-164711126 TTAAATGCTACCACCTCTGATGG - Intergenic
1018568049 6:165178100-165178122 TTTTATCCTACAGCCTATGGGGG + Intergenic
1021653185 7:22851244-22851266 TGAAATCATGCAAACTGTGGTGG - Intergenic
1023001129 7:35808614-35808636 TTAAATGCTACTTCCTTTGGAGG + Intronic
1026242954 7:68593034-68593056 TTAAATCCTACCACTTTGGGAGG - Intergenic
1026363862 7:69627837-69627859 TTTAATCCTCAAACCTGTGAGGG - Intronic
1030781938 7:113611564-113611586 GTAAATCCTACAAACTTTGGTGG + Intergenic
1033439473 7:141365871-141365893 CTAATTCCTAGAACCTGTGACGG - Intronic
1037550384 8:19965222-19965244 TTCCATCCTAAAACCAGTGGGGG + Intronic
1041332035 8:56737064-56737086 TTAAATACATCAACCTGGGGAGG - Intergenic
1044469405 8:92549123-92549145 TTTAATTCTAGATCCTGTGGTGG + Intergenic
1045986461 8:108255053-108255075 TTAGATACTTCAACCTGTAGAGG + Intronic
1046727806 8:117693508-117693530 TTCAATCCCACAACCTGGAGAGG + Intergenic
1048022207 8:130549618-130549640 CTCAATCCAACAACCTGTGAGGG - Intergenic
1051300290 9:15643413-15643435 TTTATACCTACAACCTCTGGGGG + Intronic
1057200058 9:93134938-93134960 TTCAATCATACAACAGGTGGGGG - Intergenic
1203491171 Un_GL000224v1:106646-106668 CTAAATCCTAGAACATCTGGAGG + Intergenic
1203503795 Un_KI270741v1:48517-48539 CTAAATCCTAGAACATCTGGAGG + Intergenic
1197904185 X:131406242-131406264 TGAAATCCCACAAAGTGTGGAGG - Intergenic
1199319324 X:146419832-146419854 TTAAATTCTAAAACCTAAGGTGG - Intergenic
1201323443 Y:12727875-12727897 TTAAGTCCTCCTACCTGTGGAGG - Intronic